FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634943_at:

>probe:Drosophila_2:1634943_at:130:671; Interrogation_Position=571; Antisense; TACGATTCACCAAGCTGTCCGATGC
>probe:Drosophila_2:1634943_at:24:447; Interrogation_Position=591; Antisense; GATGCGCAAGTTCTGGCCAAGCTCA
>probe:Drosophila_2:1634943_at:188:553; Interrogation_Position=657; Antisense; GGACTTGAGGCCATCGTATTCACTG
>probe:Drosophila_2:1634943_at:618:337; Interrogation_Position=726; Antisense; GCTCAGGGATTTGGCGACATCACCG
>probe:Drosophila_2:1634943_at:537:401; Interrogation_Position=741; Antisense; GACATCACCGCTGAGAACGTCTTTA
>probe:Drosophila_2:1634943_at:454:437; Interrogation_Position=798; Antisense; GAGGAGATGATCCACCATTGCGCTG
>probe:Drosophila_2:1634943_at:643:273; Interrogation_Position=813; Antisense; CATTGCGCTGCTAACGACATACACA
>probe:Drosophila_2:1634943_at:292:185; Interrogation_Position=846; Antisense; AAAATCCTGGCCAAGCTGTGGAAGC
>probe:Drosophila_2:1634943_at:283:199; Interrogation_Position=867; Antisense; AAGCTGGGATACTCGCCGGAGGACA
>probe:Drosophila_2:1634943_at:700:315; Interrogation_Position=881; Antisense; GCCGGAGGACATCATTGCGAACATA
>probe:Drosophila_2:1634943_at:539:385; Interrogation_Position=899; Antisense; GAACATATTCCGTGTCTGCAAGCGC
>probe:Drosophila_2:1634943_at:209:379; Interrogation_Position=944; Antisense; GAAGCTGGACTTTATCCGTGAGATC
>probe:Drosophila_2:1634943_at:278:427; Interrogation_Position=963; Antisense; GAGATCGGAATCACCCACATGAAGA
>probe:Drosophila_2:1634943_at:391:43; Interrogation_Position=990; Antisense; ATCGATGGTATCAACTCGCTGCTGC

Paste this into a BLAST search page for me
TACGATTCACCAAGCTGTCCGATGCGATGCGCAAGTTCTGGCCAAGCTCAGGACTTGAGGCCATCGTATTCACTGGCTCAGGGATTTGGCGACATCACCGGACATCACCGCTGAGAACGTCTTTAGAGGAGATGATCCACCATTGCGCTGCATTGCGCTGCTAACGACATACACAAAAATCCTGGCCAAGCTGTGGAAGCAAGCTGGGATACTCGCCGGAGGACAGCCGGAGGACATCATTGCGAACATAGAACATATTCCGTGTCTGCAAGCGCGAAGCTGGACTTTATCCGTGAGATCGAGATCGGAATCACCCACATGAAGAATCGATGGTATCAACTCGCTGCTGC

Full Affymetrix probeset data:

Annotations for 1634943_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720