FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634945_at:

>probe:Drosophila_2:1634945_at:299:327; Interrogation_Position=1023; Antisense; GCGATGACTGGTTTGGTGCTCCTCA
>probe:Drosophila_2:1634945_at:688:503; Interrogation_Position=1069; Antisense; TGTCCGTTTTTCGTTCGAAGGCGCA
>probe:Drosophila_2:1634945_at:125:267; Interrogation_Position=1092; Antisense; CAGGGTTATCCCTATAGTTTCTTGT
>probe:Drosophila_2:1634945_at:353:109; Interrogation_Position=1123; Antisense; AGAATCGACTGCAGTCCTGTTCCAG
>probe:Drosophila_2:1634945_at:78:93; Interrogation_Position=1152; Antisense; AGTTCACCCTATATCGTTTTTGTAG
>probe:Drosophila_2:1634945_at:583:421; Interrogation_Position=1191; Antisense; GAGCACACATTTTTCGTGCGTGTAA
>probe:Drosophila_2:1634945_at:200:15; Interrogation_Position=660; Antisense; ATTTTCCGTCCACCAAACTATTCTG
>probe:Drosophila_2:1634945_at:392:59; Interrogation_Position=696; Antisense; ATGATCACATTGGTGGCCCTGGTGG
>probe:Drosophila_2:1634945_at:500:91; Interrogation_Position=791; Antisense; AGTATTCTTCTGCTTCGCCATGATC
>probe:Drosophila_2:1634945_at:387:719; Interrogation_Position=804; Antisense; TTCGCCATGATCTCGGGTCAAATGT
>probe:Drosophila_2:1634945_at:410:131; Interrogation_Position=848; Antisense; ACCGCTGGTCCACAAGTCGCAAAAT
>probe:Drosophila_2:1634945_at:178:185; Interrogation_Position=868; Antisense; AAAATGGTGGCGTGGCCTACATCCA
>probe:Drosophila_2:1634945_at:329:425; Interrogation_Position=921; Antisense; GAGACCTATATCGTCATGTTCCTGA
>probe:Drosophila_2:1634945_at:553:367; Interrogation_Position=981; Antisense; GAATCGGGAACACCAAAGGCTCACA

Paste this into a BLAST search page for me
GCGATGACTGGTTTGGTGCTCCTCATGTCCGTTTTTCGTTCGAAGGCGCACAGGGTTATCCCTATAGTTTCTTGTAGAATCGACTGCAGTCCTGTTCCAGAGTTCACCCTATATCGTTTTTGTAGGAGCACACATTTTTCGTGCGTGTAAATTTTCCGTCCACCAAACTATTCTGATGATCACATTGGTGGCCCTGGTGGAGTATTCTTCTGCTTCGCCATGATCTTCGCCATGATCTCGGGTCAAATGTACCGCTGGTCCACAAGTCGCAAAATAAAATGGTGGCGTGGCCTACATCCAGAGACCTATATCGTCATGTTCCTGAGAATCGGGAACACCAAAGGCTCACA

Full Affymetrix probeset data:

Annotations for 1634945_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720