Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634948_at:

>probe:Drosophila_2:1634948_at:308:271; Interrogation_Position=115; Antisense; CATCGCTCATCGTCGGGATGCAGAA
>probe:Drosophila_2:1634948_at:482:633; Interrogation_Position=189; Antisense; TCGCTCTAAGTAATCAATCGTCGTA
>probe:Drosophila_2:1634948_at:6:237; Interrogation_Position=204; Antisense; AATCGTCGTAGCCAATCAAATCAAA
>probe:Drosophila_2:1634948_at:361:679; Interrogation_Position=255; Antisense; TTGCCCCACCAACAGTTTGAGTGCA
>probe:Drosophila_2:1634948_at:628:693; Interrogation_Position=270; Antisense; TTTGAGTGCACATTCATTTCGGCCC
>probe:Drosophila_2:1634948_at:139:309; Interrogation_Position=295; Antisense; CCACTGTTCCTGTTCGTGAAACATT
>probe:Drosophila_2:1634948_at:284:575; Interrogation_Position=327; Antisense; GGCCTCAAAACGGAGTCCCTAGAGT
>probe:Drosophila_2:1634948_at:517:87; Interrogation_Position=340; Antisense; AGTCCCTAGAGTTTCTGCGTTGCGA
>probe:Drosophila_2:1634948_at:416:441; Interrogation_Position=380; Antisense; GATGGATATCCTACCGAGTGGCAAC
>probe:Drosophila_2:1634948_at:38:435; Interrogation_Position=395; Antisense; GAGTGGCAACATCTTCAGCGAGCTG
>probe:Drosophila_2:1634948_at:550:281; Interrogation_Position=446; Antisense; CTCGTCGCAGCCGTCGATTGAGGAT
>probe:Drosophila_2:1634948_at:510:395; Interrogation_Position=501; Antisense; GAAATCAGCGGCGACAACCACCTTG
>probe:Drosophila_2:1634948_at:446:25; Interrogation_Position=69; Antisense; ATAGGGCAATATTCAATCGCGAGTG
>probe:Drosophila_2:1634948_at:446:433; Interrogation_Position=89; Antisense; GAGTGCTAAAATGCTGTCCTCCGCA

Paste this into a BLAST search page for me
CATCGCTCATCGTCGGGATGCAGAATCGCTCTAAGTAATCAATCGTCGTAAATCGTCGTAGCCAATCAAATCAAATTGCCCCACCAACAGTTTGAGTGCATTTGAGTGCACATTCATTTCGGCCCCCACTGTTCCTGTTCGTGAAACATTGGCCTCAAAACGGAGTCCCTAGAGTAGTCCCTAGAGTTTCTGCGTTGCGAGATGGATATCCTACCGAGTGGCAACGAGTGGCAACATCTTCAGCGAGCTGCTCGTCGCAGCCGTCGATTGAGGATGAAATCAGCGGCGACAACCACCTTGATAGGGCAATATTCAATCGCGAGTGGAGTGCTAAAATGCTGTCCTCCGCA

Full Affymetrix probeset data:

Annotations for 1634948_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime