Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634949_at:

>probe:Drosophila_2:1634949_at:676:375; Interrogation_Position=2544; Antisense; GAAGCGAAGTGCAAAATGTCGTTGC
>probe:Drosophila_2:1634949_at:309:231; Interrogation_Position=2558; Antisense; AATGTCGTTGCATTTGCTGTTTGCA
>probe:Drosophila_2:1634949_at:329:189; Interrogation_Position=2610; Antisense; AACATCAACTTGTATGCTGAGTGGA
>probe:Drosophila_2:1634949_at:664:619; Interrogation_Position=2624; Antisense; TGCTGAGTGGAAGGGAAACCGACAA
>probe:Drosophila_2:1634949_at:627:703; Interrogation_Position=2706; Antisense; TTATGTAAGCGGCAACAAGCGACAA
>probe:Drosophila_2:1634949_at:392:331; Interrogation_Position=2714; Antisense; GCGGCAACAAGCGACAATTCAAATT
>probe:Drosophila_2:1634949_at:243:637; Interrogation_Position=2732; Antisense; TCAAATTCAAGTCTCGTTTTGTTTT
>probe:Drosophila_2:1634949_at:326:709; Interrogation_Position=2762; Antisense; TTCAAATGGGTGGAACGGATTCCTT
>probe:Drosophila_2:1634949_at:453:699; Interrogation_Position=2786; Antisense; TTTTTTCAGAACTTTTATATGGCGA
>probe:Drosophila_2:1634949_at:11:155; Interrogation_Position=2842; Antisense; ACAGTTCAGAAAGACAACGTATTTG
>probe:Drosophila_2:1634949_at:465:365; Interrogation_Position=2900; Antisense; GAATAGCTTCAGAAGTACAAGCCAA
>probe:Drosophila_2:1634949_at:300:125; Interrogation_Position=2919; Antisense; AGCCAAATAGCTTTCCATACACTTA
>probe:Drosophila_2:1634949_at:502:271; Interrogation_Position=2934; Antisense; CATACACTTAGTTTCTAGTTTCCAC
>probe:Drosophila_2:1634949_at:225:639; Interrogation_Position=2949; Antisense; TAGTTTCCACCCTCCTATTAATATA

Paste this into a BLAST search page for me
GAAGCGAAGTGCAAAATGTCGTTGCAATGTCGTTGCATTTGCTGTTTGCAAACATCAACTTGTATGCTGAGTGGATGCTGAGTGGAAGGGAAACCGACAATTATGTAAGCGGCAACAAGCGACAAGCGGCAACAAGCGACAATTCAAATTTCAAATTCAAGTCTCGTTTTGTTTTTTCAAATGGGTGGAACGGATTCCTTTTTTTTCAGAACTTTTATATGGCGAACAGTTCAGAAAGACAACGTATTTGGAATAGCTTCAGAAGTACAAGCCAAAGCCAAATAGCTTTCCATACACTTACATACACTTAGTTTCTAGTTTCCACTAGTTTCCACCCTCCTATTAATATA

Full Affymetrix probeset data:

Annotations for 1634949_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime