Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634950_at:

>probe:Drosophila_2:1634950_at:564:625; Interrogation_Position=3028; Antisense; TGCCCCGCGCAGGATCAGATTACAT
>probe:Drosophila_2:1634950_at:205:273; Interrogation_Position=3050; Antisense; CATTGCTCGAATTGTGGGACTACTA
>probe:Drosophila_2:1634950_at:376:657; Interrogation_Position=3073; Antisense; TAAGATCTGCATACTCCGACTTTGC
>probe:Drosophila_2:1634950_at:191:297; Interrogation_Position=3089; Antisense; CGACTTTGCTGCGTTCTTTTACAAT
>probe:Drosophila_2:1634950_at:468:471; Interrogation_Position=3101; Antisense; GTTCTTTTACAATCCGCACGGAGGC
>probe:Drosophila_2:1634950_at:653:285; Interrogation_Position=3132; Antisense; CTGGGCATTGTATGGCGGCCACCAA
>probe:Drosophila_2:1634950_at:703:579; Interrogation_Position=3148; Antisense; GGCCACCAACGGAATTCGCTGCAAA
>probe:Drosophila_2:1634950_at:388:315; Interrogation_Position=3173; Antisense; GCCATTTAAGGTCACAGAGCTGCAG
>probe:Drosophila_2:1634950_at:252:349; Interrogation_Position=3194; Antisense; GCAGGCATGCAGTCCTTGTGGTAAT
>probe:Drosophila_2:1634950_at:192:179; Interrogation_Position=3241; Antisense; AAACACTGCTCGAGGACTTCAAACT
>probe:Drosophila_2:1634950_at:224:613; Interrogation_Position=3271; Antisense; TGAAAGATTTCTACCTGCGCATCGC
>probe:Drosophila_2:1634950_at:84:387; Interrogation_Position=3318; Antisense; GAACAGCGCGAGCATCAGAAGCCCA
>probe:Drosophila_2:1634950_at:660:205; Interrogation_Position=3336; Antisense; AAGCCCATGCGGTACTTTGATGCCA
>probe:Drosophila_2:1634950_at:470:679; Interrogation_Position=3401; Antisense; TAGGCAACGCAAGGGCACCGGGAAA

Paste this into a BLAST search page for me
TGCCCCGCGCAGGATCAGATTACATCATTGCTCGAATTGTGGGACTACTATAAGATCTGCATACTCCGACTTTGCCGACTTTGCTGCGTTCTTTTACAATGTTCTTTTACAATCCGCACGGAGGCCTGGGCATTGTATGGCGGCCACCAAGGCCACCAACGGAATTCGCTGCAAAGCCATTTAAGGTCACAGAGCTGCAGGCAGGCATGCAGTCCTTGTGGTAATAAACACTGCTCGAGGACTTCAAACTTGAAAGATTTCTACCTGCGCATCGCGAACAGCGCGAGCATCAGAAGCCCAAAGCCCATGCGGTACTTTGATGCCATAGGCAACGCAAGGGCACCGGGAAA

Full Affymetrix probeset data:

Annotations for 1634950_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime