Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634953_at:

>probe:Drosophila_2:1634953_at:538:475; Interrogation_Position=1001; Antisense; GTTAGCCGGCTGGTACAACTAGTTA
>probe:Drosophila_2:1634953_at:161:665; Interrogation_Position=1014; Antisense; TACAACTAGTTAACCTGCCAGCCTG
>probe:Drosophila_2:1634953_at:576:415; Interrogation_Position=1048; Antisense; GAGCCTGCATACGACAAACCAAAAT
>probe:Drosophila_2:1634953_at:573:49; Interrogation_Position=521; Antisense; ATGCCGTTGCCAAAATACCTCTGTA
>probe:Drosophila_2:1634953_at:725:523; Interrogation_Position=591; Antisense; GGGCACGGTCATTCAGTTCGGACCA
>probe:Drosophila_2:1634953_at:671:93; Interrogation_Position=605; Antisense; AGTTCGGACCACTGCCAGATGAGGC
>probe:Drosophila_2:1634953_at:337:33; Interrogation_Position=631; Antisense; ATCAACGGCGATATGCAGATCCTGC
>probe:Drosophila_2:1634953_at:542:207; Interrogation_Position=673; Antisense; AAGCTGCTGGGCTGGTCCAACGCTG
>probe:Drosophila_2:1634953_at:219:397; Interrogation_Position=715; Antisense; GACAAGCACGACTCCGATGTGGACA
>probe:Drosophila_2:1634953_at:472:317; Interrogation_Position=762; Antisense; GCCCCTCATCTGTGACAACATGGTG
>probe:Drosophila_2:1634953_at:248:141; Interrogation_Position=787; Antisense; ACGGGCATCGTGTCCTTCGGAATGG
>probe:Drosophila_2:1634953_at:431:573; Interrogation_Position=831; Antisense; GGCTGGGATCTACACCGATGTCTAC
>probe:Drosophila_2:1634953_at:61:61; Interrogation_Position=848; Antisense; ATGTCTACCACTTCCGGGATTGGAT
>probe:Drosophila_2:1634953_at:258:465; Interrogation_Position=865; Antisense; GATTGGATCACCGAGAACTCCTGCC

Paste this into a BLAST search page for me
GTTAGCCGGCTGGTACAACTAGTTATACAACTAGTTAACCTGCCAGCCTGGAGCCTGCATACGACAAACCAAAATATGCCGTTGCCAAAATACCTCTGTAGGGCACGGTCATTCAGTTCGGACCAAGTTCGGACCACTGCCAGATGAGGCATCAACGGCGATATGCAGATCCTGCAAGCTGCTGGGCTGGTCCAACGCTGGACAAGCACGACTCCGATGTGGACAGCCCCTCATCTGTGACAACATGGTGACGGGCATCGTGTCCTTCGGAATGGGGCTGGGATCTACACCGATGTCTACATGTCTACCACTTCCGGGATTGGATGATTGGATCACCGAGAACTCCTGCC

Full Affymetrix probeset data:

Annotations for 1634953_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime