Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634954_at:

>probe:Drosophila_2:1634954_at:304:685; Interrogation_Position=1159; Antisense; TATTTGTAGCCTTGGTCCGTTGTTA
>probe:Drosophila_2:1634954_at:416:535; Interrogation_Position=1172; Antisense; GGTCCGTTGTTAATAGCTCTTTATA
>probe:Drosophila_2:1634954_at:518:117; Interrogation_Position=1186; Antisense; AGCTCTTTATACACGCACTACATTA
>probe:Drosophila_2:1634954_at:717:359; Interrogation_Position=1270; Antisense; GCAATTCGTATTCTTAGGCTTAAAG
>probe:Drosophila_2:1634954_at:445:523; Interrogation_Position=1342; Antisense; GGGCTCTGGCTAGACATCAGTTAGT
>probe:Drosophila_2:1634954_at:147:493; Interrogation_Position=1368; Antisense; GTAACCAGATACTTTAAGCGAATCA
>probe:Drosophila_2:1634954_at:698:703; Interrogation_Position=1424; Antisense; TTGAATCCGGAAGCCAATACCAATT
>probe:Drosophila_2:1634954_at:559:671; Interrogation_Position=1441; Antisense; TACCAATTATCGCTACAAACAGAGA
>probe:Drosophila_2:1634954_at:298:661; Interrogation_Position=1499; Antisense; TAAAACATCGTGTCGTTTGCCCCGG
>probe:Drosophila_2:1634954_at:493:299; Interrogation_Position=1519; Antisense; CCCGGCGGTTTGGAGATATATTTAG
>probe:Drosophila_2:1634954_at:370:677; Interrogation_Position=1541; Antisense; TAGAGCTCTAGTTTAAGCCTAACTT
>probe:Drosophila_2:1634954_at:482:49; Interrogation_Position=1556; Antisense; AGCCTAACTTAGACGAACATCGGTT
>probe:Drosophila_2:1634954_at:85:385; Interrogation_Position=1570; Antisense; GAACATCGGTTCCACAAATCAATTG
>probe:Drosophila_2:1634954_at:484:203; Interrogation_Position=1622; Antisense; AAGCCTAGACTGATTTTAGCCATAC

Paste this into a BLAST search page for me
TATTTGTAGCCTTGGTCCGTTGTTAGGTCCGTTGTTAATAGCTCTTTATAAGCTCTTTATACACGCACTACATTAGCAATTCGTATTCTTAGGCTTAAAGGGGCTCTGGCTAGACATCAGTTAGTGTAACCAGATACTTTAAGCGAATCATTGAATCCGGAAGCCAATACCAATTTACCAATTATCGCTACAAACAGAGATAAAACATCGTGTCGTTTGCCCCGGCCCGGCGGTTTGGAGATATATTTAGTAGAGCTCTAGTTTAAGCCTAACTTAGCCTAACTTAGACGAACATCGGTTGAACATCGGTTCCACAAATCAATTGAAGCCTAGACTGATTTTAGCCATAC

Full Affymetrix probeset data:

Annotations for 1634954_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime