Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634955_at:

>probe:Drosophila_2:1634955_at:356:127; Interrogation_Position=400; Antisense; AGCCAGTTGAGCCAAGAGTGCCGTG
>probe:Drosophila_2:1634955_at:183:215; Interrogation_Position=413; Antisense; AAGAGTGCCGTGGTCGCTGGCAAAC
>probe:Drosophila_2:1634955_at:541:517; Interrogation_Position=422; Antisense; GTGGTCGCTGGCAAACGCAATTGGT
>probe:Drosophila_2:1634955_at:216:535; Interrogation_Position=424; Antisense; GGTCGCTGGCAAACGCAATTGGTGC
>probe:Drosophila_2:1634955_at:341:249; Interrogation_Position=439; Antisense; CAATTGGTGCGCAGATACTCGGCGA
>probe:Drosophila_2:1634955_at:422:505; Interrogation_Position=445; Antisense; GTGCGCAGATACTCGGCGAAACCGC
>probe:Drosophila_2:1634955_at:300:97; Interrogation_Position=451; Antisense; AGATACTCGGCGAAACCGCCGCTCT
>probe:Drosophila_2:1634955_at:95:301; Interrogation_Position=467; Antisense; CGCCGCTCTCGCTGAAGCTGATCAA
>probe:Drosophila_2:1634955_at:597:119; Interrogation_Position=482; Antisense; AGCTGATCAATGAGCGCGTCTTGCT
>probe:Drosophila_2:1634955_at:557:33; Interrogation_Position=487; Antisense; ATCAATGAGCGCGTCTTGCTTGTGC
>probe:Drosophila_2:1634955_at:627:415; Interrogation_Position=493; Antisense; GAGCGCGTCTTGCTTGTGCTCAAGC
>probe:Drosophila_2:1634955_at:725:343; Interrogation_Position=504; Antisense; GCTTGTGCTCAAGCTCTACGACAAG
>probe:Drosophila_2:1634955_at:269:43; Interrogation_Position=529; Antisense; ATCGATCCCAGCAAGCTCAACGTTG
>probe:Drosophila_2:1634955_at:11:295; Interrogation_Position=531; Antisense; CGATCCCAGCAAGCTCAACGTTGAG

Paste this into a BLAST search page for me
AGCCAGTTGAGCCAAGAGTGCCGTGAAGAGTGCCGTGGTCGCTGGCAAACGTGGTCGCTGGCAAACGCAATTGGTGGTCGCTGGCAAACGCAATTGGTGCCAATTGGTGCGCAGATACTCGGCGAGTGCGCAGATACTCGGCGAAACCGCAGATACTCGGCGAAACCGCCGCTCTCGCCGCTCTCGCTGAAGCTGATCAAAGCTGATCAATGAGCGCGTCTTGCTATCAATGAGCGCGTCTTGCTTGTGCGAGCGCGTCTTGCTTGTGCTCAAGCGCTTGTGCTCAAGCTCTACGACAAGATCGATCCCAGCAAGCTCAACGTTGCGATCCCAGCAAGCTCAACGTTGAG

Full Affymetrix probeset data:

Annotations for 1634955_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime