FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634956_at:

>probe:Drosophila_2:1634956_at:562:379; Interrogation_Position=493; Antisense; GAACCGGTGGCCAAGTATCTGCCAC
>probe:Drosophila_2:1634956_at:706:87; Interrogation_Position=592; Antisense; AGTCCGCCAGAGTCCAAGTACCTTC
>probe:Drosophila_2:1634956_at:172:411; Interrogation_Position=624; Antisense; GACGCCCGAGGTGAAGTATCTGCCA
>probe:Drosophila_2:1634956_at:491:127; Interrogation_Position=648; Antisense; ACCTGCTCCAGTGGCAAGGTATCTG
>probe:Drosophila_2:1634956_at:176:223; Interrogation_Position=663; Antisense; AAGGTATCTGCCACCCAAGGTTGCA
>probe:Drosophila_2:1634956_at:464:83; Interrogation_Position=720; Antisense; AGTGGCTCCCAAGAAGCTGTATCTT
>probe:Drosophila_2:1634956_at:609:415; Interrogation_Position=754; Antisense; GAGCCGGAGACTAAGTACCTGCCAC
>probe:Drosophila_2:1634956_at:108:501; Interrogation_Position=790; Antisense; GTCGAGAAGTATCTGCCTCCTAAGC
>probe:Drosophila_2:1634956_at:236:279; Interrogation_Position=816; Antisense; CGAACAAAAATATCTGCCACCCCAG
>probe:Drosophila_2:1634956_at:24:629; Interrogation_Position=830; Antisense; TGCCACCCCAGCCTGAGGTAGATTT
>probe:Drosophila_2:1634956_at:392:485; Interrogation_Position=847; Antisense; GTAGATTTCCACATACCGATTCCAT
>probe:Drosophila_2:1634956_at:439:257; Interrogation_Position=944; Antisense; CACTTCGCCGTTTCAGGCATTAGGA
>probe:Drosophila_2:1634956_at:556:569; Interrogation_Position=959; Antisense; GGCATTAGGATAATCAACCACCGAA
>probe:Drosophila_2:1634956_at:515:157; Interrogation_Position=997; Antisense; ACAAGCACTGCATCTAGTTTTAAGC

Paste this into a BLAST search page for me
GAACCGGTGGCCAAGTATCTGCCACAGTCCGCCAGAGTCCAAGTACCTTCGACGCCCGAGGTGAAGTATCTGCCAACCTGCTCCAGTGGCAAGGTATCTGAAGGTATCTGCCACCCAAGGTTGCAAGTGGCTCCCAAGAAGCTGTATCTTGAGCCGGAGACTAAGTACCTGCCACGTCGAGAAGTATCTGCCTCCTAAGCCGAACAAAAATATCTGCCACCCCAGTGCCACCCCAGCCTGAGGTAGATTTGTAGATTTCCACATACCGATTCCATCACTTCGCCGTTTCAGGCATTAGGAGGCATTAGGATAATCAACCACCGAAACAAGCACTGCATCTAGTTTTAAGC

Full Affymetrix probeset data:

Annotations for 1634956_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720