Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634957_at:

>probe:Drosophila_2:1634957_at:547:133; Interrogation_Position=1261; Antisense; ACCCAACGGCTTCTGAGTGCTGGAA
>probe:Drosophila_2:1634957_at:565:405; Interrogation_Position=1303; Antisense; GACGGTTCCTAATGGCTGGCTACAA
>probe:Drosophila_2:1634957_at:209:227; Interrogation_Position=1326; Antisense; AAGGCAGGCATGTTGTGTGTGCACA
>probe:Drosophila_2:1634957_at:474:597; Interrogation_Position=1343; Antisense; TGTGCACATACTCCCTTGATGACAA
>probe:Drosophila_2:1634957_at:719:605; Interrogation_Position=1359; Antisense; TGATGACAAACTTACTCCCACGTTG
>probe:Drosophila_2:1634957_at:321:145; Interrogation_Position=1372; Antisense; ACTCCCACGTTGCTAGATGTACTCG
>probe:Drosophila_2:1634957_at:510:443; Interrogation_Position=1387; Antisense; GATGTACTCGCATTTGAACTCTATT
>probe:Drosophila_2:1634957_at:171:493; Interrogation_Position=1437; Antisense; GTAACGATTTATGCTACCTCTCTCA
>probe:Drosophila_2:1634957_at:579:339; Interrogation_Position=1449; Antisense; GCTACCTCTCTCACAGATACTGTTG
>probe:Drosophila_2:1634957_at:97:165; Interrogation_Position=1479; Antisense; AAAGTCCCCGATTAATGTGAAACAT
>probe:Drosophila_2:1634957_at:650:455; Interrogation_Position=1509; Antisense; GATACCCATGCTAACGTGCATACTA
>probe:Drosophila_2:1634957_at:416:13; Interrogation_Position=1540; Antisense; ACTTTACTCTAGATCGAAATGGCCG
>probe:Drosophila_2:1634957_at:63:319; Interrogation_Position=1561; Antisense; GCCGAAACTTTAGCCAATACACCAA
>probe:Drosophila_2:1634957_at:606:239; Interrogation_Position=1576; Antisense; AATACACCAATGCTGCTAAGGATTA

Paste this into a BLAST search page for me
ACCCAACGGCTTCTGAGTGCTGGAAGACGGTTCCTAATGGCTGGCTACAAAAGGCAGGCATGTTGTGTGTGCACATGTGCACATACTCCCTTGATGACAATGATGACAAACTTACTCCCACGTTGACTCCCACGTTGCTAGATGTACTCGGATGTACTCGCATTTGAACTCTATTGTAACGATTTATGCTACCTCTCTCAGCTACCTCTCTCACAGATACTGTTGAAAGTCCCCGATTAATGTGAAACATGATACCCATGCTAACGTGCATACTAACTTTACTCTAGATCGAAATGGCCGGCCGAAACTTTAGCCAATACACCAAAATACACCAATGCTGCTAAGGATTA

Full Affymetrix probeset data:

Annotations for 1634957_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime