FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634958_at:

>probe:Drosophila_2:1634958_at:228:165; Interrogation_Position=1006; Antisense; AAATCTCGGCAGCAAGGCACCGCGG
>probe:Drosophila_2:1634958_at:152:133; Interrogation_Position=1024; Antisense; ACCGCGGCTACATCGACGTAAATGA
>probe:Drosophila_2:1634958_at:224:153; Interrogation_Position=1033; Antisense; ACATCGACGTAAATGAGGCAGGATC
>probe:Drosophila_2:1634958_at:15:263; Interrogation_Position=1063; Antisense; CAGCAGCAGTCAGTTTCATGAAGAT
>probe:Drosophila_2:1634958_at:683:373; Interrogation_Position=1082; Antisense; GAAGATAGTACCCATGATGCTCAAC
>probe:Drosophila_2:1634958_at:358:487; Interrogation_Position=1089; Antisense; GTACCCATGATGCTCAACATGAACA
>probe:Drosophila_2:1634958_at:322:109; Interrogation_Position=1114; Antisense; AGAAGCTCTTCAAGGCGGATCACCC
>probe:Drosophila_2:1634958_at:346:545; Interrogation_Position=1130; Antisense; GGATCACCCGTTCGTCTTTTACATA
>probe:Drosophila_2:1634958_at:628:643; Interrogation_Position=1144; Antisense; TCTTTTACATACGAAACCCGCAGGC
>probe:Drosophila_2:1634958_at:413:709; Interrogation_Position=1493; Antisense; TTACTTGTGTAAGTGGCGATCGCTT
>probe:Drosophila_2:1634958_at:27:327; Interrogation_Position=1508; Antisense; GCGATCGCTTATAGCCAGTGAATTA
>probe:Drosophila_2:1634958_at:152:677; Interrogation_Position=973; Antisense; TAGACGGGCTCTTTACCTCGCAAAG
>probe:Drosophila_2:1634958_at:386:275; Interrogation_Position=981; Antisense; CTCTTTACCTCGCAAAGTGGCCAAA
>probe:Drosophila_2:1634958_at:88:221; Interrogation_Position=995; Antisense; AAGTGGCCAAAAAATCTCGGCAGCA

Paste this into a BLAST search page for me
AAATCTCGGCAGCAAGGCACCGCGGACCGCGGCTACATCGACGTAAATGAACATCGACGTAAATGAGGCAGGATCCAGCAGCAGTCAGTTTCATGAAGATGAAGATAGTACCCATGATGCTCAACGTACCCATGATGCTCAACATGAACAAGAAGCTCTTCAAGGCGGATCACCCGGATCACCCGTTCGTCTTTTACATATCTTTTACATACGAAACCCGCAGGCTTACTTGTGTAAGTGGCGATCGCTTGCGATCGCTTATAGCCAGTGAATTATAGACGGGCTCTTTACCTCGCAAAGCTCTTTACCTCGCAAAGTGGCCAAAAAGTGGCCAAAAAATCTCGGCAGCA

Full Affymetrix probeset data:

Annotations for 1634958_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720