Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634959_at:

>probe:Drosophila_2:1634959_at:273:385; Interrogation_Position=113; Antisense; GAACTATCAACATTACAGGGCCACA
>probe:Drosophila_2:1634959_at:482:667; Interrogation_Position=126; Antisense; TACAGGGCCACAACGCTGGGCAGAA
>probe:Drosophila_2:1634959_at:220:381; Interrogation_Position=148; Antisense; GAACGCTCCAGGACACTTTGGATGA
>probe:Drosophila_2:1634959_at:69:85; Interrogation_Position=16; Antisense; AGTGTGTCACTGTCAATGCCATGCG
>probe:Drosophila_2:1634959_at:41:111; Interrogation_Position=270; Antisense; AGCAATATGTCCTTTACGGCCGAAA
>probe:Drosophila_2:1634959_at:217:561; Interrogation_Position=299; Antisense; GGAAACCTTTAGATGCTGCGACAAT
>probe:Drosophila_2:1634959_at:351:397; Interrogation_Position=318; Antisense; GACAATGTGTGGACTCTGATCCTAA
>probe:Drosophila_2:1634959_at:124:315; Interrogation_Position=33; Antisense; GCCATGCGCTAAAGTCATTCTTCAT
>probe:Drosophila_2:1634959_at:127:449; Interrogation_Position=335; Antisense; GATCCTAAAGGACGCGGAGTTCCGC
>probe:Drosophila_2:1634959_at:680:543; Interrogation_Position=362; Antisense; GGATCAGCATTCCTTGAAGGTCGAT
>probe:Drosophila_2:1634959_at:246:249; Interrogation_Position=395; Antisense; AATTGTGGCCTGTCTTGGAACTGAC
>probe:Drosophila_2:1634959_at:193:51; Interrogation_Position=434; Antisense; ATGCGCACTCGCACTGAAAGTTGCT
>probe:Drosophila_2:1634959_at:162:645; Interrogation_Position=54; Antisense; TCATAAAAATTCTACAGCGCGTGTG
>probe:Drosophila_2:1634959_at:180:323; Interrogation_Position=70; Antisense; GCGCGTGTGTACTAAGCTTCTAGCT

Paste this into a BLAST search page for me
GAACTATCAACATTACAGGGCCACATACAGGGCCACAACGCTGGGCAGAAGAACGCTCCAGGACACTTTGGATGAAGTGTGTCACTGTCAATGCCATGCGAGCAATATGTCCTTTACGGCCGAAAGGAAACCTTTAGATGCTGCGACAATGACAATGTGTGGACTCTGATCCTAAGCCATGCGCTAAAGTCATTCTTCATGATCCTAAAGGACGCGGAGTTCCGCGGATCAGCATTCCTTGAAGGTCGATAATTGTGGCCTGTCTTGGAACTGACATGCGCACTCGCACTGAAAGTTGCTTCATAAAAATTCTACAGCGCGTGTGGCGCGTGTGTACTAAGCTTCTAGCT

Full Affymetrix probeset data:

Annotations for 1634959_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime