Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634960_at:

>probe:Drosophila_2:1634960_at:197:483; Interrogation_Position=1060; Antisense; GTATATGTATATTACGGCTGCGCAA
>probe:Drosophila_2:1634960_at:283:481; Interrogation_Position=1066; Antisense; GTATATTACGGCTGCGCAACACTAA
>probe:Drosophila_2:1634960_at:108:671; Interrogation_Position=1072; Antisense; TACGGCTGCGCAACACTAACAAATT
>probe:Drosophila_2:1634960_at:563:255; Interrogation_Position=1085; Antisense; CACTAACAAATTGTTCCCAACAGTT
>probe:Drosophila_2:1634960_at:221:507; Interrogation_Position=1150; Antisense; GTGCTACAAAAGCATCCAAATTCAA
>probe:Drosophila_2:1634960_at:179:667; Interrogation_Position=577; Antisense; TACAGAAATATCCACAACGTACATT
>probe:Drosophila_2:1634960_at:356:261; Interrogation_Position=675; Antisense; CAGCGACAACACATGAATTACTTAT
>probe:Drosophila_2:1634960_at:69:369; Interrogation_Position=700; Antisense; GAATGTTAATTACTTTCGCAACTTG
>probe:Drosophila_2:1634960_at:673:229; Interrogation_Position=741; Antisense; AATGTCTACACATACCAGGCAGTCA
>probe:Drosophila_2:1634960_at:600:129; Interrogation_Position=754; Antisense; ACCAGGCAGTCAATTTTTATGCTAA
>probe:Drosophila_2:1634960_at:725:1; Interrogation_Position=778; Antisense; ATTGCATAAGCATCGAACACATTAA
>probe:Drosophila_2:1634960_at:639:521; Interrogation_Position=828; Antisense; GGGCTGGTAAGGATTTCAGTGTCAA
>probe:Drosophila_2:1634960_at:476:195; Interrogation_Position=892; Antisense; AACGGCAAAGACAGCGTGTTTCACT
>probe:Drosophila_2:1634960_at:542:329; Interrogation_Position=905; Antisense; GCGTGTTTCACTGTTCATATGTTAA

Paste this into a BLAST search page for me
GTATATGTATATTACGGCTGCGCAAGTATATTACGGCTGCGCAACACTAATACGGCTGCGCAACACTAACAAATTCACTAACAAATTGTTCCCAACAGTTGTGCTACAAAAGCATCCAAATTCAATACAGAAATATCCACAACGTACATTCAGCGACAACACATGAATTACTTATGAATGTTAATTACTTTCGCAACTTGAATGTCTACACATACCAGGCAGTCAACCAGGCAGTCAATTTTTATGCTAAATTGCATAAGCATCGAACACATTAAGGGCTGGTAAGGATTTCAGTGTCAAAACGGCAAAGACAGCGTGTTTCACTGCGTGTTTCACTGTTCATATGTTAA

Full Affymetrix probeset data:

Annotations for 1634960_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime