FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634963_at:

>probe:Drosophila_2:1634963_at:282:141; Interrogation_Position=4772; Antisense; ACGGACCTGAAGTATGCCCAGCAAT
>probe:Drosophila_2:1634963_at:453:247; Interrogation_Position=4793; Antisense; CAATATCATAGTTTTCAGCAGCAGT
>probe:Drosophila_2:1634963_at:265:351; Interrogation_Position=4813; Antisense; GCAGTTATATGCTACCAACACCAGA
>probe:Drosophila_2:1634963_at:632:351; Interrogation_Position=4864; Antisense; GCAGCACCAGAGCAACATGATAACA
>probe:Drosophila_2:1634963_at:61:271; Interrogation_Position=4879; Antisense; CATGATAACAATGCCGCCGAATTTA
>probe:Drosophila_2:1634963_at:593:49; Interrogation_Position=4889; Antisense; ATGCCGCCGAATTTATCACCAAATC
>probe:Drosophila_2:1634963_at:727:233; Interrogation_Position=4910; Antisense; AATCCAACGTTCTTTGTCAACAAAT
>probe:Drosophila_2:1634963_at:486:321; Interrogation_Position=4954; Antisense; GCCCTCGCCATGTATTGTTTACTAG
>probe:Drosophila_2:1634963_at:331:481; Interrogation_Position=4965; Antisense; GTATTGTTTACTAGTCTCCAAATTA
>probe:Drosophila_2:1634963_at:104:359; Interrogation_Position=5106; Antisense; GCAACTTTTAGAAGTCACGTCGAAG
>probe:Drosophila_2:1634963_at:190:93; Interrogation_Position=5197; Antisense; AGTTATCAGCAGCTATTTTCTGTTA
>probe:Drosophila_2:1634963_at:13:17; Interrogation_Position=5221; Antisense; ATTATTTAATATGTGCGCTGCTCTC
>probe:Drosophila_2:1634963_at:258:299; Interrogation_Position=5236; Antisense; CGCTGCTCTCTCTGTGTTAAATGAA
>probe:Drosophila_2:1634963_at:513:687; Interrogation_Position=5298; Antisense; TATATTGCTCTCAACTGTATTGTAA

Paste this into a BLAST search page for me
ACGGACCTGAAGTATGCCCAGCAATCAATATCATAGTTTTCAGCAGCAGTGCAGTTATATGCTACCAACACCAGAGCAGCACCAGAGCAACATGATAACACATGATAACAATGCCGCCGAATTTAATGCCGCCGAATTTATCACCAAATCAATCCAACGTTCTTTGTCAACAAATGCCCTCGCCATGTATTGTTTACTAGGTATTGTTTACTAGTCTCCAAATTAGCAACTTTTAGAAGTCACGTCGAAGAGTTATCAGCAGCTATTTTCTGTTAATTATTTAATATGTGCGCTGCTCTCCGCTGCTCTCTCTGTGTTAAATGAATATATTGCTCTCAACTGTATTGTAA

Full Affymetrix probeset data:

Annotations for 1634963_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720