FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634964_at:

>probe:Drosophila_2:1634964_at:346:169; Interrogation_Position=1019; Antisense; AAATGGTCAGATGCAATCCCTCGCA
>probe:Drosophila_2:1634964_at:445:533; Interrogation_Position=1078; Antisense; GGTGATATCGCACCCAATGAGATCA
>probe:Drosophila_2:1634964_at:717:651; Interrogation_Position=1100; Antisense; TCAATACGGCGCTGGAGAACATCAA
>probe:Drosophila_2:1634964_at:101:699; Interrogation_Position=1168; Antisense; TTTAAGATCGGCGTTAGCCCCATGC
>probe:Drosophila_2:1634964_at:590:489; Interrogation_Position=1197; Antisense; GTACTATGTTCCTGGCGGCGATCTG
>probe:Drosophila_2:1634964_at:378:535; Interrogation_Position=1280; Antisense; GGTGCCGCCTGGTCAACAAGTTCGA
>probe:Drosophila_2:1634964_at:598:415; Interrogation_Position=1322; Antisense; GAGCCTTCGTCTATCACTATGTGGG
>probe:Drosophila_2:1634964_at:94:283; Interrogation_Position=1380; Antisense; CTCCGAGAACATTTGCCAGCTGGTG
>probe:Drosophila_2:1634964_at:33:121; Interrogation_Position=1397; Antisense; AGCTGGTGCACGACTATCTGGAGGT
>probe:Drosophila_2:1634964_at:491:47; Interrogation_Position=1457; Antisense; ATCCGGAGGAGGACTCTCTCAACTA
>probe:Drosophila_2:1634964_at:640:663; Interrogation_Position=1480; Antisense; TAAAGTGTGCTCTGTATCTGACCCT
>probe:Drosophila_2:1634964_at:20:411; Interrogation_Position=1499; Antisense; GACCCTTTCGTCTGCATTTTTGAAT
>probe:Drosophila_2:1634964_at:176:495; Interrogation_Position=967; Antisense; GTCAATATGTCGACGGCCCAGCTAA
>probe:Drosophila_2:1634964_at:505:115; Interrogation_Position=986; Antisense; AGCTAACGGGTCAGTGTTTCCAGAT

Paste this into a BLAST search page for me
AAATGGTCAGATGCAATCCCTCGCAGGTGATATCGCACCCAATGAGATCATCAATACGGCGCTGGAGAACATCAATTTAAGATCGGCGTTAGCCCCATGCGTACTATGTTCCTGGCGGCGATCTGGGTGCCGCCTGGTCAACAAGTTCGAGAGCCTTCGTCTATCACTATGTGGGCTCCGAGAACATTTGCCAGCTGGTGAGCTGGTGCACGACTATCTGGAGGTATCCGGAGGAGGACTCTCTCAACTATAAAGTGTGCTCTGTATCTGACCCTGACCCTTTCGTCTGCATTTTTGAATGTCAATATGTCGACGGCCCAGCTAAAGCTAACGGGTCAGTGTTTCCAGAT

Full Affymetrix probeset data:

Annotations for 1634964_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720