Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634966_a_at:

>probe:Drosophila_2:1634966_a_at:273:695; Interrogation_Position=154; Antisense; TTCCCTTGACTTTAAACGATCTCCA
>probe:Drosophila_2:1634966_a_at:340:177; Interrogation_Position=167; Antisense; AAACGATCTCCAAGTAGTCAATACA
>probe:Drosophila_2:1634966_a_at:184:485; Interrogation_Position=180; Antisense; GTAGTCAATACAGCACGCAATAAGC
>probe:Drosophila_2:1634966_a_at:182:135; Interrogation_Position=194; Antisense; ACGCAATAAGCAAGATGGTGGACAA
>probe:Drosophila_2:1634966_a_at:6:399; Interrogation_Position=214; Antisense; GACAAAATTGAAATGAGCCTCGACG
>probe:Drosophila_2:1634966_a_at:385:57; Interrogation_Position=226; Antisense; ATGAGCCTCGACGACATCATTAAGT
>probe:Drosophila_2:1634966_a_at:614:409; Interrogation_Position=235; Antisense; GACGACATCATTAAGTCCACACGCT
>probe:Drosophila_2:1634966_a_at:156:13; Interrogation_Position=244; Antisense; ATTAAGTCCACACGCTCGCAAAAAA
>probe:Drosophila_2:1634966_a_at:648:197; Interrogation_Position=309; Antisense; AACGGGCGGACAGCAGCGTTTTGCT
>probe:Drosophila_2:1634966_a_at:114:263; Interrogation_Position=322; Antisense; CAGCGTTTTGCTGGTGGAGCCCGCC
>probe:Drosophila_2:1634966_a_at:168:233; Interrogation_Position=358; Antisense; AATGCCGGCGGCTCGCCCAGGAAGC
>probe:Drosophila_2:1634966_a_at:330:309; Interrogation_Position=374; Antisense; CCAGGAAGCCAGGAAGCGTGCTCAA
>probe:Drosophila_2:1634966_a_at:470:299; Interrogation_Position=420; Antisense; CGCCGGAGCCGTTCAGAAGGCCAAG
>probe:Drosophila_2:1634966_a_at:190:473; Interrogation_Position=430; Antisense; GTTCAGAAGGCCAAGTTCCCACGGG

Paste this into a BLAST search page for me
TTCCCTTGACTTTAAACGATCTCCAAAACGATCTCCAAGTAGTCAATACAGTAGTCAATACAGCACGCAATAAGCACGCAATAAGCAAGATGGTGGACAAGACAAAATTGAAATGAGCCTCGACGATGAGCCTCGACGACATCATTAAGTGACGACATCATTAAGTCCACACGCTATTAAGTCCACACGCTCGCAAAAAAAACGGGCGGACAGCAGCGTTTTGCTCAGCGTTTTGCTGGTGGAGCCCGCCAATGCCGGCGGCTCGCCCAGGAAGCCCAGGAAGCCAGGAAGCGTGCTCAACGCCGGAGCCGTTCAGAAGGCCAAGGTTCAGAAGGCCAAGTTCCCACGGG

Full Affymetrix probeset data:

Annotations for 1634966_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime