Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634969_at:

>probe:Drosophila_2:1634969_at:244:557; Interrogation_Position=2122; Antisense; GGACTACTTTTATTTGGCACCAAGC
>probe:Drosophila_2:1634969_at:663:289; Interrogation_Position=2158; Antisense; CGTAACTTCATCACCTCGATTTTGA
>probe:Drosophila_2:1634969_at:292:715; Interrogation_Position=2189; Antisense; TTCGGATGATTCTTGGCGACTTTCA
>probe:Drosophila_2:1634969_at:429:575; Interrogation_Position=2203; Antisense; GGCGACTTTCAGTACAACCTCATTG
>probe:Drosophila_2:1634969_at:17:207; Interrogation_Position=2231; Antisense; AAGCGAATCGAGTGCTGGGTCCCAT
>probe:Drosophila_2:1634969_at:388:667; Interrogation_Position=2269; Antisense; TACATCCTTCTTGTGTTCTTCATTC
>probe:Drosophila_2:1634969_at:236:513; Interrogation_Position=2345; Antisense; GTGAGATCACCCAAGGACGCAGTCA
>probe:Drosophila_2:1634969_at:207:297; Interrogation_Position=2362; Antisense; CGCAGTCACTTAGGATCGTACATCT
>probe:Drosophila_2:1634969_at:154:667; Interrogation_Position=2386; Antisense; TACAGGAAACTGTCGGGCATGCTCT
>probe:Drosophila_2:1634969_at:649:49; Interrogation_Position=2404; Antisense; ATGCTCTACTGGATCACCCATTGTG
>probe:Drosophila_2:1634969_at:672:561; Interrogation_Position=2481; Antisense; GGAACATGATGTTGGCGCCGCGCAC
>probe:Drosophila_2:1634969_at:532:319; Interrogation_Position=2497; Antisense; GCCGCGCACGATGAAACTCACGAAA
>probe:Drosophila_2:1634969_at:113:399; Interrogation_Position=2535; Antisense; GACACCAGCAGAGCAACAGTACTTT
>probe:Drosophila_2:1634969_at:505:247; Interrogation_Position=2601; Antisense; CAATAACCGTGTGGGCCTCCTTGAG

Paste this into a BLAST search page for me
GGACTACTTTTATTTGGCACCAAGCCGTAACTTCATCACCTCGATTTTGATTCGGATGATTCTTGGCGACTTTCAGGCGACTTTCAGTACAACCTCATTGAAGCGAATCGAGTGCTGGGTCCCATTACATCCTTCTTGTGTTCTTCATTCGTGAGATCACCCAAGGACGCAGTCACGCAGTCACTTAGGATCGTACATCTTACAGGAAACTGTCGGGCATGCTCTATGCTCTACTGGATCACCCATTGTGGGAACATGATGTTGGCGCCGCGCACGCCGCGCACGATGAAACTCACGAAAGACACCAGCAGAGCAACAGTACTTTCAATAACCGTGTGGGCCTCCTTGAG

Full Affymetrix probeset data:

Annotations for 1634969_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime