FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634970_at:

>probe:Drosophila_2:1634970_at:475:553; Interrogation_Position=1770; Antisense; GGAGCCCATGGGTCATTTGGCACAG
>probe:Drosophila_2:1634970_at:496:567; Interrogation_Position=1788; Antisense; GGCACAGACCGTACTTACCTGGATA
>probe:Drosophila_2:1634970_at:502:685; Interrogation_Position=1811; Antisense; TATCGTATCCATTTCAGCTGCTCAA
>probe:Drosophila_2:1634970_at:56:485; Interrogation_Position=1841; Antisense; GTATCGAGGCGTTCTGGCCGTGCAA
>probe:Drosophila_2:1634970_at:544:581; Interrogation_Position=1855; Antisense; TGGCCGTGCAATCTGCTGCAGCAGT
>probe:Drosophila_2:1634970_at:56:619; Interrogation_Position=1871; Antisense; TGCAGCAGTTGTCTCGCGTCTAAGC
>probe:Drosophila_2:1634970_at:327:329; Interrogation_Position=1886; Antisense; GCGTCTAAGCCGGAGGTCACACACT
>probe:Drosophila_2:1634970_at:569:635; Interrogation_Position=1927; Antisense; TCGAATGACGTCACACACACTCACA
>probe:Drosophila_2:1634970_at:545:347; Interrogation_Position=1982; Antisense; GCATCCATCTCCATGTGGCTGAGAA
>probe:Drosophila_2:1634970_at:32:567; Interrogation_Position=2014; Antisense; GGCAGAAGGCCACGGAACCACTCAA
>probe:Drosophila_2:1634970_at:249:243; Interrogation_Position=2117; Antisense; AATATGTCTGTGTTGTCTTCGTGAA
>probe:Drosophila_2:1634970_at:65:181; Interrogation_Position=2169; Antisense; AAACACGCACTCAACTAGTTCCAGC
>probe:Drosophila_2:1634970_at:540:677; Interrogation_Position=2184; Antisense; TAGTTCCAGCTTCCAAGTGATCCGG
>probe:Drosophila_2:1634970_at:99:649; Interrogation_Position=2226; Antisense; TCAGCAGCCACGCAAGAGGAAACTA

Paste this into a BLAST search page for me
GGAGCCCATGGGTCATTTGGCACAGGGCACAGACCGTACTTACCTGGATATATCGTATCCATTTCAGCTGCTCAAGTATCGAGGCGTTCTGGCCGTGCAATGGCCGTGCAATCTGCTGCAGCAGTTGCAGCAGTTGTCTCGCGTCTAAGCGCGTCTAAGCCGGAGGTCACACACTTCGAATGACGTCACACACACTCACAGCATCCATCTCCATGTGGCTGAGAAGGCAGAAGGCCACGGAACCACTCAAAATATGTCTGTGTTGTCTTCGTGAAAAACACGCACTCAACTAGTTCCAGCTAGTTCCAGCTTCCAAGTGATCCGGTCAGCAGCCACGCAAGAGGAAACTA

Full Affymetrix probeset data:

Annotations for 1634970_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720