FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634971_at:

>probe:Drosophila_2:1634971_at:202:391; Interrogation_Position=1006; Antisense; GAAAGCTACCGATGAGATGCACATA
>probe:Drosophila_2:1634971_at:184:351; Interrogation_Position=1068; Antisense; GCAGATACATTCGTGCCGTTGGCAT
>probe:Drosophila_2:1634971_at:396:525; Interrogation_Position=1102; Antisense; GGGCTTCTCACCCATGAATAATACA
>probe:Drosophila_2:1634971_at:309:481; Interrogation_Position=1130; Antisense; GTATTGCTCCACGATCACGATGAGT
>probe:Drosophila_2:1634971_at:536:443; Interrogation_Position=1148; Antisense; GATGAGTTCATTCAGGCGGATATCT
>probe:Drosophila_2:1634971_at:144:291; Interrogation_Position=1164; Antisense; CGGATATCTATTTGCGCGGTGTGCA
>probe:Drosophila_2:1634971_at:423:323; Interrogation_Position=1177; Antisense; GCGCGGTGTGCAGATATTTCAGAAA
>probe:Drosophila_2:1634971_at:236:655; Interrogation_Position=775; Antisense; TAATTTGACCAAACTCGGTGGCGGA
>probe:Drosophila_2:1634971_at:414:229; Interrogation_Position=809; Antisense; AATGTGGTGCCTCCCTTGCTAATGG
>probe:Drosophila_2:1634971_at:116:275; Interrogation_Position=823; Antisense; CTTGCTAATGGTCTGCTTCGATTGT
>probe:Drosophila_2:1634971_at:656:275; Interrogation_Position=838; Antisense; CTTCGATTGTCGTTTGGCTCTAGAT
>probe:Drosophila_2:1634971_at:466:437; Interrogation_Position=881; Antisense; GAGGCTAACCTCCACAAATGGTGTG
>probe:Drosophila_2:1634971_at:304:533; Interrogation_Position=917; Antisense; GGTGGCATCGAGATCACTTACGAAC
>probe:Drosophila_2:1634971_at:580:235; Interrogation_Position=983; Antisense; AATCCCTTCTGGCTTGCTTTCAAGA

Paste this into a BLAST search page for me
GAAAGCTACCGATGAGATGCACATAGCAGATACATTCGTGCCGTTGGCATGGGCTTCTCACCCATGAATAATACAGTATTGCTCCACGATCACGATGAGTGATGAGTTCATTCAGGCGGATATCTCGGATATCTATTTGCGCGGTGTGCAGCGCGGTGTGCAGATATTTCAGAAATAATTTGACCAAACTCGGTGGCGGAAATGTGGTGCCTCCCTTGCTAATGGCTTGCTAATGGTCTGCTTCGATTGTCTTCGATTGTCGTTTGGCTCTAGATGAGGCTAACCTCCACAAATGGTGTGGGTGGCATCGAGATCACTTACGAACAATCCCTTCTGGCTTGCTTTCAAGA

Full Affymetrix probeset data:

Annotations for 1634971_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720