FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634972_at:

>probe:Drosophila_2:1634972_at:285:141; Interrogation_Position=1008; Antisense; ACGGACTACGACTGCTGGCGCATGG
>probe:Drosophila_2:1634972_at:635:531; Interrogation_Position=1040; Antisense; GGGTGTCAACGTGCAGGATGTCCTC
>probe:Drosophila_2:1634972_at:11:63; Interrogation_Position=1057; Antisense; ATGTCCTCCGTACTTTTGCCGAGAA
>probe:Drosophila_2:1634972_at:367:375; Interrogation_Position=1094; Antisense; GAAGAAGATTCTGGTCAACGCTGTT
>probe:Drosophila_2:1634972_at:255:495; Interrogation_Position=1107; Antisense; GTCAACGCTGTTGGTCGAATTGCCA
>probe:Drosophila_2:1634972_at:266:213; Interrogation_Position=1237; Antisense; AAGAGACGCTGATTCGCCGCAAGAT
>probe:Drosophila_2:1634972_at:447:361; Interrogation_Position=1255; Antisense; GCAAGATTTATGTGCCACCGCTCTA
>probe:Drosophila_2:1634972_at:299:99; Interrogation_Position=1308; Antisense; AGAGTTCACTCCATATCCATTACGT
>probe:Drosophila_2:1634972_at:163:73; Interrogation_Position=1356; Antisense; AGGCAGCCGGTGAAAACTCCATTGA
>probe:Drosophila_2:1634972_at:526:227; Interrogation_Position=1381; Antisense; AATGTGAAACTGTAACGTCCGCGTC
>probe:Drosophila_2:1634972_at:325:633; Interrogation_Position=1398; Antisense; TCCGCGTCAGCGTCGCAGTAAATAT
>probe:Drosophila_2:1634972_at:543:425; Interrogation_Position=897; Antisense; GAGAGCCACATGTTCCGTCAGTGGG
>probe:Drosophila_2:1634972_at:716:139; Interrogation_Position=945; Antisense; ACGTGTCCAGAAGTGGTGCTAGCCA
>probe:Drosophila_2:1634972_at:295:667; Interrogation_Position=982; Antisense; TACTTTACGGGTCGGTGGCCATTGC

Paste this into a BLAST search page for me
ACGGACTACGACTGCTGGCGCATGGGGGTGTCAACGTGCAGGATGTCCTCATGTCCTCCGTACTTTTGCCGAGAAGAAGAAGATTCTGGTCAACGCTGTTGTCAACGCTGTTGGTCGAATTGCCAAAGAGACGCTGATTCGCCGCAAGATGCAAGATTTATGTGCCACCGCTCTAAGAGTTCACTCCATATCCATTACGTAGGCAGCCGGTGAAAACTCCATTGAAATGTGAAACTGTAACGTCCGCGTCTCCGCGTCAGCGTCGCAGTAAATATGAGAGCCACATGTTCCGTCAGTGGGACGTGTCCAGAAGTGGTGCTAGCCATACTTTACGGGTCGGTGGCCATTGC

Full Affymetrix probeset data:

Annotations for 1634972_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720