Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634973_s_at:

>probe:Drosophila_2:1634973_s_at:645:105; Interrogation_Position=1044; Antisense; AGAACAAACTACTCTGTGATTTCGA
>probe:Drosophila_2:1634973_s_at:341:729; Interrogation_Position=1122; Antisense; TTGGCATGATGAACGGCGCCCTCAG
>probe:Drosophila_2:1634973_s_at:257:421; Interrogation_Position=1172; Antisense; GAGCAAGTAAGCAGTGCACCACTAA
>probe:Drosophila_2:1634973_s_at:575:429; Interrogation_Position=673; Antisense; GAGTTTTAACACAAGTGCCTCGCAA
>probe:Drosophila_2:1634973_s_at:148:507; Interrogation_Position=687; Antisense; GTGCCTCGCAAAATCCGCTAAGCAA
>probe:Drosophila_2:1634973_s_at:490:359; Interrogation_Position=708; Antisense; GCAACGCCTACAGTTTGGGAGTCAC
>probe:Drosophila_2:1634973_s_at:130:143; Interrogation_Position=731; Antisense; ACTGGCGGTGCTGGAAGTGACTACT
>probe:Drosophila_2:1634973_s_at:562:653; Interrogation_Position=752; Antisense; TACTGTGGCTTTGGAAAACACCCGC
>probe:Drosophila_2:1634973_s_at:414:187; Interrogation_Position=768; Antisense; AACACCCGCCAATATTGATCGATCA
>probe:Drosophila_2:1634973_s_at:620:35; Interrogation_Position=789; Antisense; ATCAGGAGACGTTTCTCAGCCTCAA
>probe:Drosophila_2:1634973_s_at:523:649; Interrogation_Position=804; Antisense; TCAGCCTCAATCCAGCGGACTTTGA
>probe:Drosophila_2:1634973_s_at:441:289; Interrogation_Position=819; Antisense; CGGACTTTGAGGACATTGTGCCATC
>probe:Drosophila_2:1634973_s_at:310:729; Interrogation_Position=834; Antisense; TTGTGCCATCCAATTCGGAGCCCAA
>probe:Drosophila_2:1634973_s_at:494:123; Interrogation_Position=852; Antisense; AGCCCAATTCGCTGGTTTTCATCGA

Paste this into a BLAST search page for me
AGAACAAACTACTCTGTGATTTCGATTGGCATGATGAACGGCGCCCTCAGGAGCAAGTAAGCAGTGCACCACTAAGAGTTTTAACACAAGTGCCTCGCAAGTGCCTCGCAAAATCCGCTAAGCAAGCAACGCCTACAGTTTGGGAGTCACACTGGCGGTGCTGGAAGTGACTACTTACTGTGGCTTTGGAAAACACCCGCAACACCCGCCAATATTGATCGATCAATCAGGAGACGTTTCTCAGCCTCAATCAGCCTCAATCCAGCGGACTTTGACGGACTTTGAGGACATTGTGCCATCTTGTGCCATCCAATTCGGAGCCCAAAGCCCAATTCGCTGGTTTTCATCGA

Full Affymetrix probeset data:

Annotations for 1634973_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime