FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634975_at:

>probe:Drosophila_2:1634975_at:461:251; Interrogation_Position=1027; Antisense; CAAGTTTGTTCAGTCAAGTTCCGAA
>probe:Drosophila_2:1634975_at:479:493; Interrogation_Position=1039; Antisense; GTCAAGTTCCGAACTCTCACCGAAG
>probe:Drosophila_2:1634975_at:370:187; Interrogation_Position=1085; Antisense; AACACTTGCTTTTCCAACTTATCAC
>probe:Drosophila_2:1634975_at:100:645; Interrogation_Position=1134; Antisense; TCTTAAGTTATAATCCACCGGGCAA
>probe:Drosophila_2:1634975_at:369:565; Interrogation_Position=1200; Antisense; GGAATTCTCTTTGGCCAAAAGCACT
>probe:Drosophila_2:1634975_at:61:183; Interrogation_Position=1216; Antisense; AAAAGCACTCGGCATTCCTTGATTT
>probe:Drosophila_2:1634975_at:389:727; Interrogation_Position=1245; Antisense; TTGATTATCTTTTGAGCCTTTGCTC
>probe:Drosophila_2:1634975_at:332:619; Interrogation_Position=1265; Antisense; TGCTCAGTCTGCTTCCTACATATTA
>probe:Drosophila_2:1634975_at:31:687; Interrogation_Position=1293; Antisense; TATAACTCTTATTTTGGCTGCACGT
>probe:Drosophila_2:1634975_at:214:573; Interrogation_Position=1308; Antisense; GGCTGCACGTTTTCCAAGCTAATTT
>probe:Drosophila_2:1634975_at:501:267; Interrogation_Position=824; Antisense; CAGTGCGACGTCAATCTTATTCCAG
>probe:Drosophila_2:1634975_at:431:653; Interrogation_Position=834; Antisense; TCAATCTTATTCCAGGTCTCGCTCA
>probe:Drosophila_2:1634975_at:499:499; Interrogation_Position=849; Antisense; GTCTCGCTCACGTTCTAACTATTAA
>probe:Drosophila_2:1634975_at:413:651; Interrogation_Position=956; Antisense; TCAATATTTGTTCAAGACCCCTCAA

Paste this into a BLAST search page for me
CAAGTTTGTTCAGTCAAGTTCCGAAGTCAAGTTCCGAACTCTCACCGAAGAACACTTGCTTTTCCAACTTATCACTCTTAAGTTATAATCCACCGGGCAAGGAATTCTCTTTGGCCAAAAGCACTAAAAGCACTCGGCATTCCTTGATTTTTGATTATCTTTTGAGCCTTTGCTCTGCTCAGTCTGCTTCCTACATATTATATAACTCTTATTTTGGCTGCACGTGGCTGCACGTTTTCCAAGCTAATTTCAGTGCGACGTCAATCTTATTCCAGTCAATCTTATTCCAGGTCTCGCTCAGTCTCGCTCACGTTCTAACTATTAATCAATATTTGTTCAAGACCCCTCAA

Full Affymetrix probeset data:

Annotations for 1634975_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720