Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634976_at:

>probe:Drosophila_2:1634976_at:46:617; Interrogation_Position=341; Antisense; TGCAAGTGTTGCACACCCTGCTGCG
>probe:Drosophila_2:1634976_at:633:335; Interrogation_Position=456; Antisense; GCTGCTCTCCTTGCGGAGGGTCAAA
>probe:Drosophila_2:1634976_at:631:509; Interrogation_Position=481; Antisense; GTGCAAGTGATCCACGGCAGCGAAT
>probe:Drosophila_2:1634976_at:322:29; Interrogation_Position=504; Antisense; ATACGGATTCGTTTTCGGAGGCAGG
>probe:Drosophila_2:1634976_at:7:77; Interrogation_Position=526; Antisense; AGGAGCTAGGCGCAAATGCCACCAC
>probe:Drosophila_2:1634976_at:237:167; Interrogation_Position=539; Antisense; AAATGCCACCACAAGTTCGTCGAGC
>probe:Drosophila_2:1634976_at:336:159; Interrogation_Position=549; Antisense; ACAAGTTCGTCGAGCTCGTTGGAGA
>probe:Drosophila_2:1634976_at:633:465; Interrogation_Position=566; Antisense; GTTGGAGAGCCGTTGGAGCCCACCT
>probe:Drosophila_2:1634976_at:137:307; Interrogation_Position=588; Antisense; CCTGCTATTACCAGCTAAGGCAATC
>probe:Drosophila_2:1634976_at:717:493; Interrogation_Position=626; Antisense; GTCAACGGCAGAGCCAAGTTCTCAG
>probe:Drosophila_2:1634976_at:10:399; Interrogation_Position=722; Antisense; GACACAGATTAGACAGCGGGCCCAG
>probe:Drosophila_2:1634976_at:344:327; Interrogation_Position=737; Antisense; GCGGGCCCAGGTAAAAGTTGGTCAT
>probe:Drosophila_2:1634976_at:201:647; Interrogation_Position=758; Antisense; TCATCCCCAACTTATGCCAGTTAGT
>probe:Drosophila_2:1634976_at:479:311; Interrogation_Position=773; Antisense; GCCAGTTAGTGCTGTGTAAAGTTTT

Paste this into a BLAST search page for me
TGCAAGTGTTGCACACCCTGCTGCGGCTGCTCTCCTTGCGGAGGGTCAAAGTGCAAGTGATCCACGGCAGCGAATATACGGATTCGTTTTCGGAGGCAGGAGGAGCTAGGCGCAAATGCCACCACAAATGCCACCACAAGTTCGTCGAGCACAAGTTCGTCGAGCTCGTTGGAGAGTTGGAGAGCCGTTGGAGCCCACCTCCTGCTATTACCAGCTAAGGCAATCGTCAACGGCAGAGCCAAGTTCTCAGGACACAGATTAGACAGCGGGCCCAGGCGGGCCCAGGTAAAAGTTGGTCATTCATCCCCAACTTATGCCAGTTAGTGCCAGTTAGTGCTGTGTAAAGTTTT

Full Affymetrix probeset data:

Annotations for 1634976_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime