FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634977_at:

>probe:Drosophila_2:1634977_at:79:171; Interrogation_Position=129; Antisense; AAAGGACCAACTCATCCTGGGACTG
>probe:Drosophila_2:1634977_at:296:267; Interrogation_Position=145; Antisense; CTGGGACTGTACATTGCCGTTGGGT
>probe:Drosophila_2:1634977_at:491:497; Interrogation_Position=175; Antisense; GTCTTCTTGCTCTCATTTTTTGGAT
>probe:Drosophila_2:1634977_at:710:101; Interrogation_Position=218; Antisense; AGAGCATCTGTGTTACCTGGGCGTA
>probe:Drosophila_2:1634977_at:256:485; Interrogation_Position=240; Antisense; GTATGCCACCTCGATGCTGGTAATG
>probe:Drosophila_2:1634977_at:158:51; Interrogation_Position=253; Antisense; ATGCTGGTAATGCTGATCGTCTCAA
>probe:Drosophila_2:1634977_at:676:25; Interrogation_Position=277; Antisense; ATAGTCATGCTTTTTGTCTTCCGTA
>probe:Drosophila_2:1634977_at:663:375; Interrogation_Position=310; Antisense; GAAGAAGACTCCATTACCAAGCTGA
>probe:Drosophila_2:1634977_at:199:153; Interrogation_Position=359; Antisense; ACACTTTCGACGCAATGGCCGAGTA
>probe:Drosophila_2:1634977_at:692:423; Interrogation_Position=431; Antisense; GAGACGCCTACATAACTGTTCCAAG
>probe:Drosophila_2:1634977_at:241:457; Interrogation_Position=475; Antisense; GATACGCCCTACAGAGACGGTTGTC
>probe:Drosophila_2:1634977_at:653:553; Interrogation_Position=525; Antisense; GGAGCTCCTCAAGGGTCCTAAGATT
>probe:Drosophila_2:1634977_at:132:247; Interrogation_Position=57; Antisense; CAATTTTCTTTGTGCGGTCCTGGGC
>probe:Drosophila_2:1634977_at:235:221; Interrogation_Position=618; Antisense; AAGGAACGAACTACGACGCTCTGCG

Paste this into a BLAST search page for me
AAAGGACCAACTCATCCTGGGACTGCTGGGACTGTACATTGCCGTTGGGTGTCTTCTTGCTCTCATTTTTTGGATAGAGCATCTGTGTTACCTGGGCGTAGTATGCCACCTCGATGCTGGTAATGATGCTGGTAATGCTGATCGTCTCAAATAGTCATGCTTTTTGTCTTCCGTAGAAGAAGACTCCATTACCAAGCTGAACACTTTCGACGCAATGGCCGAGTAGAGACGCCTACATAACTGTTCCAAGGATACGCCCTACAGAGACGGTTGTCGGAGCTCCTCAAGGGTCCTAAGATTCAATTTTCTTTGTGCGGTCCTGGGCAAGGAACGAACTACGACGCTCTGCG

Full Affymetrix probeset data:

Annotations for 1634977_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720