FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634978_at:

>probe:Drosophila_2:1634978_at:636:161; Interrogation_Position=135; Antisense; ACAATTCAGTTGCAGTTGCCCCAGG
>probe:Drosophila_2:1634978_at:78:719; Interrogation_Position=180; Antisense; TTCGAGTGGCGCACACAGGTGGCCA
>probe:Drosophila_2:1634978_at:299:603; Interrogation_Position=221; Antisense; TGATCCCGCCCACGAGGAGAAGTGC
>probe:Drosophila_2:1634978_at:683:677; Interrogation_Position=248; Antisense; TAGTGGGCACCAGAGCACGGAAGCT
>probe:Drosophila_2:1634978_at:637:365; Interrogation_Position=335; Antisense; GAATCTGCCCCAAACGTTGAGCAAT
>probe:Drosophila_2:1634978_at:163:363; Interrogation_Position=355; Antisense; GCAATTTCTTCGAGGCGGAGCGCTA
>probe:Drosophila_2:1634978_at:190:125; Interrogation_Position=384; Antisense; AGCGCCTGGAATCGCGTGACCAAAT
>probe:Drosophila_2:1634978_at:117:609; Interrogation_Position=400; Antisense; TGACCAAATAGGCTGCTCTTCCAGT
>probe:Drosophila_2:1634978_at:703:519; Interrogation_Position=460; Antisense; GGGAGGCCTAATCGATTAACCCATT
>probe:Drosophila_2:1634978_at:360:511; Interrogation_Position=507; Antisense; GTGAAATTCCATTCCGTTGCCAAAA
>probe:Drosophila_2:1634978_at:15:647; Interrogation_Position=534; Antisense; TCATGCCCCAAAATTGCTTACCGGA
>probe:Drosophila_2:1634978_at:41:335; Interrogation_Position=589; Antisense; GCTGCCCAGGGCTAAACCAACTATG
>probe:Drosophila_2:1634978_at:76:53; Interrogation_Position=628; Antisense; ATGAATATTTATGTGCCACCCTCCT
>probe:Drosophila_2:1634978_at:403:305; Interrogation_Position=647; Antisense; CCTCCTGTACCCTGATAATGCAATA

Paste this into a BLAST search page for me
ACAATTCAGTTGCAGTTGCCCCAGGTTCGAGTGGCGCACACAGGTGGCCATGATCCCGCCCACGAGGAGAAGTGCTAGTGGGCACCAGAGCACGGAAGCTGAATCTGCCCCAAACGTTGAGCAATGCAATTTCTTCGAGGCGGAGCGCTAAGCGCCTGGAATCGCGTGACCAAATTGACCAAATAGGCTGCTCTTCCAGTGGGAGGCCTAATCGATTAACCCATTGTGAAATTCCATTCCGTTGCCAAAATCATGCCCCAAAATTGCTTACCGGAGCTGCCCAGGGCTAAACCAACTATGATGAATATTTATGTGCCACCCTCCTCCTCCTGTACCCTGATAATGCAATA

Full Affymetrix probeset data:

Annotations for 1634978_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720