FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634979_at:

>probe:Drosophila_2:1634979_at:547:81; Interrogation_Position=1003; Antisense; AGGGAACTCGCACCAATTTCAGCAG
>probe:Drosophila_2:1634979_at:45:159; Interrogation_Position=1043; Antisense; ACACTTTATTGTGATGGCCCTGCTC
>probe:Drosophila_2:1634979_at:200:209; Interrogation_Position=1137; Antisense; AAGCAGTACGCCCACATTGTGAACG
>probe:Drosophila_2:1634979_at:531:611; Interrogation_Position=1156; Antisense; TGAACGCTCTGCCAAAATCCAATTC
>probe:Drosophila_2:1634979_at:688:233; Interrogation_Position=1171; Antisense; AATCCAATTCGGACATCCTTAGCCT
>probe:Drosophila_2:1634979_at:530:75; Interrogation_Position=1255; Antisense; AGGAGTATCTTCAAGGACACCGCGC
>probe:Drosophila_2:1634979_at:400:41; Interrogation_Position=1285; Antisense; ATCGATTTAACAAACCCTGGCGCGC
>probe:Drosophila_2:1634979_at:612:305; Interrogation_Position=1300; Antisense; CCTGGCGCGCCAATTACATTTATTG
>probe:Drosophila_2:1634979_at:261:7; Interrogation_Position=1321; Antisense; ATTGCATCCAGGTACTTCTGATTTT
>probe:Drosophila_2:1634979_at:142:327; Interrogation_Position=842; Antisense; GCGAGACTTCTTGCACATTAAACTT
>probe:Drosophila_2:1634979_at:138:705; Interrogation_Position=865; Antisense; TTATCATCTACATGGACGCCTTGCA
>probe:Drosophila_2:1634979_at:232:655; Interrogation_Position=895; Antisense; TAATTTCCCTTCGTTCGCGTCAAAT
>probe:Drosophila_2:1634979_at:457:169; Interrogation_Position=923; Antisense; AAAGGCTGAGCTCTCTGGTATCACG
>probe:Drosophila_2:1634979_at:288:23; Interrogation_Position=964; Antisense; ATATACGCCATCGTTTTGCGGATCC

Paste this into a BLAST search page for me
AGGGAACTCGCACCAATTTCAGCAGACACTTTATTGTGATGGCCCTGCTCAAGCAGTACGCCCACATTGTGAACGTGAACGCTCTGCCAAAATCCAATTCAATCCAATTCGGACATCCTTAGCCTAGGAGTATCTTCAAGGACACCGCGCATCGATTTAACAAACCCTGGCGCGCCCTGGCGCGCCAATTACATTTATTGATTGCATCCAGGTACTTCTGATTTTGCGAGACTTCTTGCACATTAAACTTTTATCATCTACATGGACGCCTTGCATAATTTCCCTTCGTTCGCGTCAAATAAAGGCTGAGCTCTCTGGTATCACGATATACGCCATCGTTTTGCGGATCC

Full Affymetrix probeset data:

Annotations for 1634979_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720