FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634981_at:

>probe:Drosophila_2:1634981_at:73:661; Interrogation_Position=1003; Antisense; TAACGAGACCGGATATTCCTGCCGT
>probe:Drosophila_2:1634981_at:328:723; Interrogation_Position=1032; Antisense; TTGACCTAGTTCTCTATGCCCAGTT
>probe:Drosophila_2:1634981_at:199:51; Interrogation_Position=1047; Antisense; ATGCCCAGTTGGTCGACCAATGCGA
>probe:Drosophila_2:1634981_at:50:115; Interrogation_Position=632; Antisense; AGCAGCAAACTCTGGCGGGATGGAC
>probe:Drosophila_2:1634981_at:150:411; Interrogation_Position=654; Antisense; GACGCAGTGGCATGACCAACATCAT
>probe:Drosophila_2:1634981_at:541:203; Interrogation_Position=702; Antisense; AAGCCGTCGGCAAGGTGATTCCGGA
>probe:Drosophila_2:1634981_at:627:139; Interrogation_Position=743; Antisense; ACGGGTATGGCTTTCCGTGTACCAG
>probe:Drosophila_2:1634981_at:31:93; Interrogation_Position=766; Antisense; AGTTCCCAATGTCTCGGTGGTGGAC
>probe:Drosophila_2:1634981_at:188:555; Interrogation_Position=787; Antisense; GGACCTCACCTGTAGGCTTTCTAAG
>probe:Drosophila_2:1634981_at:403:711; Interrogation_Position=805; Antisense; TTCTAAGCCCGCCAAAATGGACGAT
>probe:Drosophila_2:1634981_at:66:517; Interrogation_Position=899; Antisense; GTGGTGTCCACCGATTTTAACGGCT
>probe:Drosophila_2:1634981_at:307:699; Interrogation_Position=913; Antisense; TTTTAACGGCTCACGATTTGCATCC
>probe:Drosophila_2:1634981_at:37:461; Interrogation_Position=927; Antisense; GATTTGCATCCGTCTTTGATGCCAA
>probe:Drosophila_2:1634981_at:314:47; Interrogation_Position=945; Antisense; ATGCCAAGGCCTGTATTGCCCTAAA

Paste this into a BLAST search page for me
TAACGAGACCGGATATTCCTGCCGTTTGACCTAGTTCTCTATGCCCAGTTATGCCCAGTTGGTCGACCAATGCGAAGCAGCAAACTCTGGCGGGATGGACGACGCAGTGGCATGACCAACATCATAAGCCGTCGGCAAGGTGATTCCGGAACGGGTATGGCTTTCCGTGTACCAGAGTTCCCAATGTCTCGGTGGTGGACGGACCTCACCTGTAGGCTTTCTAAGTTCTAAGCCCGCCAAAATGGACGATGTGGTGTCCACCGATTTTAACGGCTTTTTAACGGCTCACGATTTGCATCCGATTTGCATCCGTCTTTGATGCCAAATGCCAAGGCCTGTATTGCCCTAAA

Full Affymetrix probeset data:

Annotations for 1634981_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720