FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634982_at:

>probe:Drosophila_2:1634982_at:87:121; Interrogation_Position=486; Antisense; AGCTGGTATCCCTGTGGAACTCCAT
>probe:Drosophila_2:1634982_at:402:235; Interrogation_Position=532; Antisense; AATCCACCACTTCTATGCGGAGAAC
>probe:Drosophila_2:1634982_at:606:381; Interrogation_Position=553; Antisense; GAACTTTTGGGAACATTGCGCCGCC
>probe:Drosophila_2:1634982_at:647:573; Interrogation_Position=582; Antisense; GGCTGTCGCCGGTCAGCTATGTGAC
>probe:Drosophila_2:1634982_at:605:421; Interrogation_Position=623; Antisense; GAGAATCTGGTGCTGGCCGTTTCCC
>probe:Drosophila_2:1634982_at:304:319; Interrogation_Position=638; Antisense; GCCGTTTCCCACAGCTTATATATTG
>probe:Drosophila_2:1634982_at:205:81; Interrogation_Position=666; Antisense; AGGTGCGTAAGTTCAACAGCGCCAA
>probe:Drosophila_2:1634982_at:658:205; Interrogation_Position=689; Antisense; AAGCTGGCTCCGGATGTTTTGCGTG
>probe:Drosophila_2:1634982_at:469:377; Interrogation_Position=781; Antisense; GAAGCAGGCCGACCTTATCGCCTAT
>probe:Drosophila_2:1634982_at:344:623; Interrogation_Position=807; Antisense; TGCGTGACCATACACACAAGCTCAA
>probe:Drosophila_2:1634982_at:47:233; Interrogation_Position=847; Antisense; AATGCAGACCAACGTGCGACCAGTG
>probe:Drosophila_2:1634982_at:416:509; Interrogation_Position=869; Antisense; GTGAGGGCACCACAAATTCCTTAAA
>probe:Drosophila_2:1634982_at:669:547; Interrogation_Position=938; Antisense; GGATGTTCTCTTTTTATTCGTTTAT
>probe:Drosophila_2:1634982_at:395:11; Interrogation_Position=953; Antisense; ATTCGTTTATACTTTGTTCATGGCG

Paste this into a BLAST search page for me
AGCTGGTATCCCTGTGGAACTCCATAATCCACCACTTCTATGCGGAGAACGAACTTTTGGGAACATTGCGCCGCCGGCTGTCGCCGGTCAGCTATGTGACGAGAATCTGGTGCTGGCCGTTTCCCGCCGTTTCCCACAGCTTATATATTGAGGTGCGTAAGTTCAACAGCGCCAAAAGCTGGCTCCGGATGTTTTGCGTGGAAGCAGGCCGACCTTATCGCCTATTGCGTGACCATACACACAAGCTCAAAATGCAGACCAACGTGCGACCAGTGGTGAGGGCACCACAAATTCCTTAAAGGATGTTCTCTTTTTATTCGTTTATATTCGTTTATACTTTGTTCATGGCG

Full Affymetrix probeset data:

Annotations for 1634982_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720