FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634986_at:

>probe:Drosophila_2:1634986_at:602:641; Interrogation_Position=106; Antisense; TCTTTACTGCCCCGATCAGCGGGTG
>probe:Drosophila_2:1634986_at:95:65; Interrogation_Position=13; Antisense; ATGGAACTGTCCAATGCACACCCAA
>probe:Drosophila_2:1634986_at:662:585; Interrogation_Position=14; Antisense; TGGAACTGTCCAATGCACACCCAAA
>probe:Drosophila_2:1634986_at:706:193; Interrogation_Position=17; Antisense; AACTGTCCAATGCACACCCAAACAG
>probe:Drosophila_2:1634986_at:7:181; Interrogation_Position=36; Antisense; AAACAGCCTGGCCAGGACGCTAGGA
>probe:Drosophila_2:1634986_at:424:123; Interrogation_Position=40; Antisense; AGCCTGGCCAGGACGCTAGGAACCG
>probe:Drosophila_2:1634986_at:598:579; Interrogation_Position=44; Antisense; TGGCCAGGACGCTAGGAACCGCAGC
>probe:Drosophila_2:1634986_at:166:75; Interrogation_Position=49; Antisense; AGGACGCTAGGAACCGCAGCTGCAG
>probe:Drosophila_2:1634986_at:272:563; Interrogation_Position=58; Antisense; GGAACCGCAGCTGCAGCCAATGCTG
>probe:Drosophila_2:1634986_at:189:133; Interrogation_Position=61; Antisense; ACCGCAGCTGCAGCCAATGCTGAGA
>probe:Drosophila_2:1634986_at:307:353; Interrogation_Position=64; Antisense; GCAGCTGCAGCCAATGCTGAGAAGA
>probe:Drosophila_2:1634986_at:661:261; Interrogation_Position=71; Antisense; CAGCCAATGCTGAGAAGACTCAAAC
>probe:Drosophila_2:1634986_at:331:609; Interrogation_Position=81; Antisense; TGAGAAGACTCAAACGACTCCACCC
>probe:Drosophila_2:1634986_at:681:421; Interrogation_Position=82; Antisense; GAGAAGACTCAAACGACTCCACCCT

Paste this into a BLAST search page for me
TCTTTACTGCCCCGATCAGCGGGTGATGGAACTGTCCAATGCACACCCAATGGAACTGTCCAATGCACACCCAAAAACTGTCCAATGCACACCCAAACAGAAACAGCCTGGCCAGGACGCTAGGAAGCCTGGCCAGGACGCTAGGAACCGTGGCCAGGACGCTAGGAACCGCAGCAGGACGCTAGGAACCGCAGCTGCAGGGAACCGCAGCTGCAGCCAATGCTGACCGCAGCTGCAGCCAATGCTGAGAGCAGCTGCAGCCAATGCTGAGAAGACAGCCAATGCTGAGAAGACTCAAACTGAGAAGACTCAAACGACTCCACCCGAGAAGACTCAAACGACTCCACCCT

Full Affymetrix probeset data:

Annotations for 1634986_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720