FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634989_at:

>probe:Drosophila_2:1634989_at:36:635; Interrogation_Position=2578; Antisense; TCGCCAATCCCGCTGATTACGATAA
>probe:Drosophila_2:1634989_at:277:705; Interrogation_Position=2594; Antisense; TTACGATAAGATCCAGCCCACGAGC
>probe:Drosophila_2:1634989_at:313:185; Interrogation_Position=2619; Antisense; AAAATCTCCCTGCTCAACCTGAAAT
>probe:Drosophila_2:1634989_at:605:283; Interrogation_Position=2637; Antisense; CTGAAATCCCTTGCGCCTGGAAAGC
>probe:Drosophila_2:1634989_at:138:393; Interrogation_Position=2656; Antisense; GAAAGCCCGTAGATGCCGAAATCAA
>probe:Drosophila_2:1634989_at:40:437; Interrogation_Position=2699; Antisense; GAGGATCAAGCTTAACCACACCCTG
>probe:Drosophila_2:1634989_at:705:135; Interrogation_Position=2725; Antisense; ACGACCTACAGATCGGCTGGTTCAA
>probe:Drosophila_2:1634989_at:147:263; Interrogation_Position=2756; Antisense; CAGCGCTCTCAACCGCATGAAGGAG
>probe:Drosophila_2:1634989_at:613:553; Interrogation_Position=2777; Antisense; GGAGCTGGCCCAGTAAATGGTCCTG
>probe:Drosophila_2:1634989_at:228:57; Interrogation_Position=2793; Antisense; ATGGTCCTGGACCTACTTAAGACAC
>probe:Drosophila_2:1634989_at:83:87; Interrogation_Position=2820; Antisense; AGTCAAGAAGCCTGATCCCAACCTT
>probe:Drosophila_2:1634989_at:198:309; Interrogation_Position=2837; Antisense; CCAACCTTCTTCCTGTAGGTGAACA
>probe:Drosophila_2:1634989_at:17:247; Interrogation_Position=3040; Antisense; AATTCTGGCTATGCATGCGTTTCCT
>probe:Drosophila_2:1634989_at:272:167; Interrogation_Position=3093; Antisense; AAATGCTCTACAGATTGCCTCTACT

Paste this into a BLAST search page for me
TCGCCAATCCCGCTGATTACGATAATTACGATAAGATCCAGCCCACGAGCAAAATCTCCCTGCTCAACCTGAAATCTGAAATCCCTTGCGCCTGGAAAGCGAAAGCCCGTAGATGCCGAAATCAAGAGGATCAAGCTTAACCACACCCTGACGACCTACAGATCGGCTGGTTCAACAGCGCTCTCAACCGCATGAAGGAGGGAGCTGGCCCAGTAAATGGTCCTGATGGTCCTGGACCTACTTAAGACACAGTCAAGAAGCCTGATCCCAACCTTCCAACCTTCTTCCTGTAGGTGAACAAATTCTGGCTATGCATGCGTTTCCTAAATGCTCTACAGATTGCCTCTACT

Full Affymetrix probeset data:

Annotations for 1634989_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720