FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634991_at:

>probe:Drosophila_2:1634991_at:46:45; Interrogation_Position=1526; Antisense; ATCGCCTTCCTAAATGGTCTGGTCA
>probe:Drosophila_2:1634991_at:527:589; Interrogation_Position=1540; Antisense; TGGTCTGGTCAGTTGGTTTGGTTAC
>probe:Drosophila_2:1634991_at:426:671; Interrogation_Position=1562; Antisense; TACCTGGTGGGTCTCGAGCAAATCG
>probe:Drosophila_2:1634991_at:583:459; Interrogation_Position=1597; Antisense; GATATTCTCTAAGCTGTTCATCCCG
>probe:Drosophila_2:1634991_at:714:531; Interrogation_Position=1675; Antisense; GGTGGCCACCAAAACCATTATCAAT
>probe:Drosophila_2:1634991_at:28:251; Interrogation_Position=1696; Antisense; CAATGAGTTTGTGGCCTATGAGCGT
>probe:Drosophila_2:1634991_at:350:417; Interrogation_Position=1715; Antisense; GAGCGTCTGGGTCAATACATCGAAA
>probe:Drosophila_2:1634991_at:109:241; Interrogation_Position=1739; Antisense; AATAATGATATCACTGCCCGCAGCG
>probe:Drosophila_2:1634991_at:27:93; Interrogation_Position=1805; Antisense; AGTTCCCTGGGCATCCTTATCGGAT
>probe:Drosophila_2:1634991_at:437:681; Interrogation_Position=1822; Antisense; TATCGGATCCCTCAGTGCTATGGCA
>probe:Drosophila_2:1634991_at:206:709; Interrogation_Position=1866; Antisense; TTACAGCAGTGGCTTTCCGAGCGTT
>probe:Drosophila_2:1634991_at:702:567; Interrogation_Position=1898; Antisense; GGCAGCATAGTCTGTTTCGTATCCG
>probe:Drosophila_2:1634991_at:619:263; Interrogation_Position=1924; Antisense; CAGCTTTGCAGGCATCCTTATACAA
>probe:Drosophila_2:1634991_at:303:415; Interrogation_Position=1958; Antisense; GAGCGGGCGAACTACAACAGGATAT

Paste this into a BLAST search page for me
ATCGCCTTCCTAAATGGTCTGGTCATGGTCTGGTCAGTTGGTTTGGTTACTACCTGGTGGGTCTCGAGCAAATCGGATATTCTCTAAGCTGTTCATCCCGGGTGGCCACCAAAACCATTATCAATCAATGAGTTTGTGGCCTATGAGCGTGAGCGTCTGGGTCAATACATCGAAAAATAATGATATCACTGCCCGCAGCGAGTTCCCTGGGCATCCTTATCGGATTATCGGATCCCTCAGTGCTATGGCATTACAGCAGTGGCTTTCCGAGCGTTGGCAGCATAGTCTGTTTCGTATCCGCAGCTTTGCAGGCATCCTTATACAAGAGCGGGCGAACTACAACAGGATAT

Full Affymetrix probeset data:

Annotations for 1634991_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720