FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634993_at:

>probe:Drosophila_2:1634993_at:624:11; Interrogation_Position=110; Antisense; ATTCTCCAACAGGATCCGTGAGGCG
>probe:Drosophila_2:1634993_at:159:675; Interrogation_Position=139; Antisense; TACCACCATCCTCGTAATGCAGTTA
>probe:Drosophila_2:1634993_at:509:231; Interrogation_Position=154; Antisense; AATGCAGTTAGTTCTGGCACCGGAA
>probe:Drosophila_2:1634993_at:682:353; Interrogation_Position=170; Antisense; GCACCGGAATGCTTGACAGCCAGGT
>probe:Drosophila_2:1634993_at:242:715; Interrogation_Position=251; Antisense; TTCTTTGCGGTGCTGGTATTATTCC
>probe:Drosophila_2:1634993_at:724:555; Interrogation_Position=293; Antisense; GGAACGTATTTAGACACCGACTTGA
>probe:Drosophila_2:1634993_at:394:195; Interrogation_Position=330; Antisense; AACTGGTGTTTTGACAACGCGCCAT
>probe:Drosophila_2:1634993_at:19:523; Interrogation_Position=381; Antisense; GGGCGGACGTAATAACTCTCCTACA
>probe:Drosophila_2:1634993_at:578:193; Interrogation_Position=394; Antisense; AACTCTCCTACAGATGTTTCCGTTG
>probe:Drosophila_2:1634993_at:552:477; Interrogation_Position=409; Antisense; GTTTCCGTTGTAAATTGCGGCTCTT
>probe:Drosophila_2:1634993_at:556:71; Interrogation_Position=520; Antisense; AGGCAGTGGAATCTGAACTTCGCAA
>probe:Drosophila_2:1634993_at:124:251; Interrogation_Position=566; Antisense; CAAGGCGGCTGCACTTTATATTCGT
>probe:Drosophila_2:1634993_at:102:411; Interrogation_Position=68; Antisense; GACGCTATAGCACGCAAAGTTCTGA
>probe:Drosophila_2:1634993_at:156:331; Interrogation_Position=95; Antisense; GCGGCGAAACATTTCATTCTCCAAC

Paste this into a BLAST search page for me
ATTCTCCAACAGGATCCGTGAGGCGTACCACCATCCTCGTAATGCAGTTAAATGCAGTTAGTTCTGGCACCGGAAGCACCGGAATGCTTGACAGCCAGGTTTCTTTGCGGTGCTGGTATTATTCCGGAACGTATTTAGACACCGACTTGAAACTGGTGTTTTGACAACGCGCCATGGGCGGACGTAATAACTCTCCTACAAACTCTCCTACAGATGTTTCCGTTGGTTTCCGTTGTAAATTGCGGCTCTTAGGCAGTGGAATCTGAACTTCGCAACAAGGCGGCTGCACTTTATATTCGTGACGCTATAGCACGCAAAGTTCTGAGCGGCGAAACATTTCATTCTCCAAC

Full Affymetrix probeset data:

Annotations for 1634993_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720