FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634995_at:

>probe:Drosophila_2:1634995_at:679:175; Interrogation_Position=1041; Antisense; AAACGCCACATGATGTTTTGTCCAA
>probe:Drosophila_2:1634995_at:181:577; Interrogation_Position=1093; Antisense; GGCCCGCTATATACGCAAGGTTCTT
>probe:Drosophila_2:1634995_at:394:359; Interrogation_Position=1107; Antisense; GCAAGGTTCTTTACCATAACGACGA
>probe:Drosophila_2:1634995_at:36:525; Interrogation_Position=1188; Antisense; GGGACACCCAAAAGGCGCCTGTAGA
>probe:Drosophila_2:1634995_at:664:487; Interrogation_Position=1244; Antisense; GTAAACGGTTCTGAATTGCTAGTTC
>probe:Drosophila_2:1634995_at:638:401; Interrogation_Position=1282; Antisense; GACATCTCTGGTTGTTCAGTTCAAT
>probe:Drosophila_2:1634995_at:282:119; Interrogation_Position=735; Antisense; AGCTCGATGAGAGTCTGGCCGATGA
>probe:Drosophila_2:1634995_at:642:99; Interrogation_Position=765; Antisense; AGATGTGCCACGATCCCTGCAAGGA
>probe:Drosophila_2:1634995_at:131:25; Interrogation_Position=793; Antisense; ATATGAAGCTGTCATCGGCCGGACT
>probe:Drosophila_2:1634995_at:93:55; Interrogation_Position=828; Antisense; ATGACTTCTACGAAGGCCAGTCGCG
>probe:Drosophila_2:1634995_at:256:441; Interrogation_Position=857; Antisense; GATGGAGCCTTCTGCGAGTACACGC
>probe:Drosophila_2:1634995_at:201:47; Interrogation_Position=895; Antisense; ATCCTACTTGGAGACGCTGCAGAGC
>probe:Drosophila_2:1634995_at:698:99; Interrogation_Position=939; Antisense; AGATGGAGAGCTTGGCCTTTGCCGC
>probe:Drosophila_2:1634995_at:173:329; Interrogation_Position=992; Antisense; GCGGTCGTCTGTGTGGCCATCCTGA

Paste this into a BLAST search page for me
AAACGCCACATGATGTTTTGTCCAAGGCCCGCTATATACGCAAGGTTCTTGCAAGGTTCTTTACCATAACGACGAGGGACACCCAAAAGGCGCCTGTAGAGTAAACGGTTCTGAATTGCTAGTTCGACATCTCTGGTTGTTCAGTTCAATAGCTCGATGAGAGTCTGGCCGATGAAGATGTGCCACGATCCCTGCAAGGAATATGAAGCTGTCATCGGCCGGACTATGACTTCTACGAAGGCCAGTCGCGGATGGAGCCTTCTGCGAGTACACGCATCCTACTTGGAGACGCTGCAGAGCAGATGGAGAGCTTGGCCTTTGCCGCGCGGTCGTCTGTGTGGCCATCCTGA

Full Affymetrix probeset data:

Annotations for 1634995_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720