FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634997_at:

>probe:Drosophila_2:1634997_at:165:171; Interrogation_Position=137; Antisense; AAAGAACTCTACGAGCGTCCCAAGT
>probe:Drosophila_2:1634997_at:536:559; Interrogation_Position=181; Antisense; GGAACTACCAATGGGCTCTTCAGGA
>probe:Drosophila_2:1634997_at:601:723; Interrogation_Position=206; Antisense; TTGTGTCTGCCGTTGTTTCCAAAAC
>probe:Drosophila_2:1634997_at:260:75; Interrogation_Position=268; Antisense; AGGAGGGTAGATCCCCATTTGTGCC
>probe:Drosophila_2:1634997_at:446:247; Interrogation_Position=28; Antisense; AATTGCTGCTTTTGTTATTGGCCGT
>probe:Drosophila_2:1634997_at:195:627; Interrogation_Position=309; Antisense; TGCCGTTCCTTCATCTGCAAAAAGT
>probe:Drosophila_2:1634997_at:341:307; Interrogation_Position=325; Antisense; GCAAAAAGTGCAGCGTGGGTTTCCC
>probe:Drosophila_2:1634997_at:517:591; Interrogation_Position=340; Antisense; TGGGTTTCCCCGTGGTTGCTGAATT
>probe:Drosophila_2:1634997_at:270:287; Interrogation_Position=373; Antisense; CGGCTCCCTGTGGATGCAATCGAAA
>probe:Drosophila_2:1634997_at:712:391; Interrogation_Position=394; Antisense; GAAAGCCAGGATCGATTGCCACAGA
>probe:Drosophila_2:1634997_at:81:667; Interrogation_Position=426; Antisense; TACAGTTTGTGCCACCTGCTGAAAT
>probe:Drosophila_2:1634997_at:208:689; Interrogation_Position=43; Antisense; TATTGGCCGTTTCGTGGTTCCACCA
>probe:Drosophila_2:1634997_at:375:203; Interrogation_Position=469; Antisense; AACCATTCCTGACTTATTCCTATTG
>probe:Drosophila_2:1634997_at:134:703; Interrogation_Position=482; Antisense; TTATTCCTATTGTTGGCCCTTCTAA

Paste this into a BLAST search page for me
AAAGAACTCTACGAGCGTCCCAAGTGGAACTACCAATGGGCTCTTCAGGATTGTGTCTGCCGTTGTTTCCAAAACAGGAGGGTAGATCCCCATTTGTGCCAATTGCTGCTTTTGTTATTGGCCGTTGCCGTTCCTTCATCTGCAAAAAGTGCAAAAAGTGCAGCGTGGGTTTCCCTGGGTTTCCCCGTGGTTGCTGAATTCGGCTCCCTGTGGATGCAATCGAAAGAAAGCCAGGATCGATTGCCACAGATACAGTTTGTGCCACCTGCTGAAATTATTGGCCGTTTCGTGGTTCCACCAAACCATTCCTGACTTATTCCTATTGTTATTCCTATTGTTGGCCCTTCTAA

Full Affymetrix probeset data:

Annotations for 1634997_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720