FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634998_at:

>probe:Drosophila_2:1634998_at:488:295; Interrogation_Position=124; Antisense; CGAGTGAGTCGCCAAATTCCCTATT
>probe:Drosophila_2:1634998_at:517:693; Interrogation_Position=140; Antisense; TTCCCTATTTGGGTGGCTACGGAGG
>probe:Drosophila_2:1634998_at:240:329; Interrogation_Position=15; Antisense; GCGTAGCTGGTTTTTATTTGGATTA
>probe:Drosophila_2:1634998_at:238:571; Interrogation_Position=259; Antisense; GGCTATGGAAGCTACGCCGGCATAC
>probe:Drosophila_2:1634998_at:96:147; Interrogation_Position=291; Antisense; ACTTTATCCCTACGGCAATCTGTAT
>probe:Drosophila_2:1634998_at:261:671; Interrogation_Position=301; Antisense; TACGGCAATCTGTATGGCGGCAGCG
>probe:Drosophila_2:1634998_at:539:521; Interrogation_Position=339; Antisense; GGGCGGATATTATGGTCGTCCTTAT
>probe:Drosophila_2:1634998_at:468:543; Interrogation_Position=34; Antisense; GGATTATATGCGCTGCTAATCGCCG
>probe:Drosophila_2:1634998_at:336:551; Interrogation_Position=351; Antisense; TGGTCGTCCTTATGGTTATGGCGGT
>probe:Drosophila_2:1634998_at:524:243; Interrogation_Position=382; Antisense; AATATTGGATATCCGGCCATTGGCG
>probe:Drosophila_2:1634998_at:522:331; Interrogation_Position=425; Antisense; GCGGCATCTTTGGTGTTAGTCCATT
>probe:Drosophila_2:1634998_at:424:339; Interrogation_Position=48; Antisense; GCTAATCGCCGCAACAGTTGGCCAA
>probe:Drosophila_2:1634998_at:295:465; Interrogation_Position=64; Antisense; GTTGGCCAACCGCTGCAGCAAAATG
>probe:Drosophila_2:1634998_at:560:333; Interrogation_Position=75; Antisense; GCTGCAGCAAAATGAGTCCGGAAAA

Paste this into a BLAST search page for me
CGAGTGAGTCGCCAAATTCCCTATTTTCCCTATTTGGGTGGCTACGGAGGGCGTAGCTGGTTTTTATTTGGATTAGGCTATGGAAGCTACGCCGGCATACACTTTATCCCTACGGCAATCTGTATTACGGCAATCTGTATGGCGGCAGCGGGGCGGATATTATGGTCGTCCTTATGGATTATATGCGCTGCTAATCGCCGTGGTCGTCCTTATGGTTATGGCGGTAATATTGGATATCCGGCCATTGGCGGCGGCATCTTTGGTGTTAGTCCATTGCTAATCGCCGCAACAGTTGGCCAAGTTGGCCAACCGCTGCAGCAAAATGGCTGCAGCAAAATGAGTCCGGAAAA

Full Affymetrix probeset data:

Annotations for 1634998_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720