Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635001_at:

>probe:Drosophila_2:1635001_at:726:643; Interrogation_Position=3741; Antisense; TCATCTTCCGGGTACAGTAGTGGCG
>probe:Drosophila_2:1635001_at:472:363; Interrogation_Position=3775; Antisense; GAATTGTTTCGCGATCAGTGCCCTC
>probe:Drosophila_2:1635001_at:204:161; Interrogation_Position=3824; Antisense; AAATAGCCTCACATCGTTGAATGGA
>probe:Drosophila_2:1635001_at:654:521; Interrogation_Position=3907; Antisense; GTGGCGTCGGAAATGGTTTCTTCAC
>probe:Drosophila_2:1635001_at:313:713; Interrogation_Position=3927; Antisense; TTCACCATCTCTGACTCGTTTAATT
>probe:Drosophila_2:1635001_at:499:545; Interrogation_Position=3957; Antisense; GGATCTACGTCCAATAACAGTCAGT
>probe:Drosophila_2:1635001_at:484:87; Interrogation_Position=3975; Antisense; AGTCAGTTGGGTTACGCACACTCCT
>probe:Drosophila_2:1635001_at:226:507; Interrogation_Position=4003; Antisense; GTGCCCGCAATTCACTAGACATATC
>probe:Drosophila_2:1635001_at:466:189; Interrogation_Position=4055; Antisense; AACTCAACGTTTCCGATACAGTCCG
>probe:Drosophila_2:1635001_at:241:261; Interrogation_Position=4089; Antisense; CACCGCGATTTCCTCATAAATGGCA
>probe:Drosophila_2:1635001_at:506:187; Interrogation_Position=4113; Antisense; AACACCATCGATAGCTTACCGTCAT
>probe:Drosophila_2:1635001_at:638:547; Interrogation_Position=4149; Antisense; GGAGGAGTTGTTCCGACCGATCCTA
>probe:Drosophila_2:1635001_at:211:401; Interrogation_Position=4206; Antisense; GACAGTGCCCCGAGCAGTGCAGATG
>probe:Drosophila_2:1635001_at:40:533; Interrogation_Position=4248; Antisense; GGTGTCACAGGCATACTCGACGATT

Paste this into a BLAST search page for me
TCATCTTCCGGGTACAGTAGTGGCGGAATTGTTTCGCGATCAGTGCCCTCAAATAGCCTCACATCGTTGAATGGAGTGGCGTCGGAAATGGTTTCTTCACTTCACCATCTCTGACTCGTTTAATTGGATCTACGTCCAATAACAGTCAGTAGTCAGTTGGGTTACGCACACTCCTGTGCCCGCAATTCACTAGACATATCAACTCAACGTTTCCGATACAGTCCGCACCGCGATTTCCTCATAAATGGCAAACACCATCGATAGCTTACCGTCATGGAGGAGTTGTTCCGACCGATCCTAGACAGTGCCCCGAGCAGTGCAGATGGGTGTCACAGGCATACTCGACGATT

Full Affymetrix probeset data:

Annotations for 1635001_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime