FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635002_at:

>probe:Drosophila_2:1635002_at:728:613; Interrogation_Position=110; Antisense; TGAAGAACACGCTCCTTGAGGACTT
>probe:Drosophila_2:1635002_at:677:607; Interrogation_Position=126; Antisense; TGAGGACTTCTACCATGCCGAGCTG
>probe:Drosophila_2:1635002_at:166:605; Interrogation_Position=149; Antisense; TGATCCAGCCCGAGGCGCCAAAGAG
>probe:Drosophila_2:1635002_at:264:71; Interrogation_Position=178; Antisense; AGGCGCGGCATCTGGGACATACCCG
>probe:Drosophila_2:1635002_at:584:39; Interrogation_Position=187; Antisense; ATCTGGGACATACCCGGGCCAAAGA
>probe:Drosophila_2:1635002_at:533:513; Interrogation_Position=19; Antisense; GTGATACTGTTGCTGGCCCTGGCAC
>probe:Drosophila_2:1635002_at:479:265; Interrogation_Position=202; Antisense; GGGCCAAAGAGGATTCCCTTCCTGG
>probe:Drosophila_2:1635002_at:636:299; Interrogation_Position=217; Antisense; CCCTTCCTGGGCACTAAGTGGATAT
>probe:Drosophila_2:1635002_at:480:221; Interrogation_Position=232; Antisense; AAGTGGATATTCCTGCTCTTCTTTC
>probe:Drosophila_2:1635002_at:109:283; Interrogation_Position=244; Antisense; CTGCTCTTCTTTCGACGGTACAAGA
>probe:Drosophila_2:1635002_at:237:491; Interrogation_Position=261; Antisense; GTACAAGATGACCAAGCTGCACGAG
>probe:Drosophila_2:1635002_at:396:127; Interrogation_Position=271; Antisense; ACCAAGCTGCACGAGGTATATGCGG
>probe:Drosophila_2:1635002_at:26:357; Interrogation_Position=40; Antisense; GCACTCGTACTTGGCTGCTACTGCG
>probe:Drosophila_2:1635002_at:597:641; Interrogation_Position=66; Antisense; TCTCCATCGGCACAAATTGGCGGAT

Paste this into a BLAST search page for me
TGAAGAACACGCTCCTTGAGGACTTTGAGGACTTCTACCATGCCGAGCTGTGATCCAGCCCGAGGCGCCAAAGAGAGGCGCGGCATCTGGGACATACCCGATCTGGGACATACCCGGGCCAAAGAGTGATACTGTTGCTGGCCCTGGCACGGGCCAAAGAGGATTCCCTTCCTGGCCCTTCCTGGGCACTAAGTGGATATAAGTGGATATTCCTGCTCTTCTTTCCTGCTCTTCTTTCGACGGTACAAGAGTACAAGATGACCAAGCTGCACGAGACCAAGCTGCACGAGGTATATGCGGGCACTCGTACTTGGCTGCTACTGCGTCTCCATCGGCACAAATTGGCGGAT

Full Affymetrix probeset data:

Annotations for 1635002_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720