FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635003_at:

>probe:Drosophila_2:1635003_at:195:419; Interrogation_Position=1030; Antisense; GAGCTGCTCAAGTTGTCCGACTATT
>probe:Drosophila_2:1635003_at:139:689; Interrogation_Position=1051; Antisense; TATTTGCGCAAAATCGCTCACCACT
>probe:Drosophila_2:1635003_at:365:145; Interrogation_Position=1073; Antisense; ACTGCCCGGATTTCAATTCGCTAAA
>probe:Drosophila_2:1635003_at:34:419; Interrogation_Position=1111; Antisense; GAGCACTACCATCCCAAGAAGAACT
>probe:Drosophila_2:1635003_at:230:211; Interrogation_Position=1129; Antisense; AAGAACTCCTGAACTTATCCTCGGT
>probe:Drosophila_2:1635003_at:208:675; Interrogation_Position=617; Antisense; TAGACTATACCCTATTCGATCACCG
>probe:Drosophila_2:1635003_at:534:551; Interrogation_Position=663; Antisense; GGAGCTAATGCGTCCGTATCTGCAC
>probe:Drosophila_2:1635003_at:373:483; Interrogation_Position=678; Antisense; GTATCTGCACGAGTTTCTGACTTCC
>probe:Drosophila_2:1635003_at:204:223; Interrogation_Position=802; Antisense; AAGGTGATGTTCTATCTGGACTCCA
>probe:Drosophila_2:1635003_at:143:459; Interrogation_Position=834; Antisense; GATATCAGTTCATGTGCCGGAGCGC
>probe:Drosophila_2:1635003_at:281:493; Interrogation_Position=886; Antisense; GTAATCTGGGCCCTGTACAAGCAAT
>probe:Drosophila_2:1635003_at:42:603; Interrogation_Position=932; Antisense; TGTTTGATGACATCCGTCGCAACTT
>probe:Drosophila_2:1635003_at:407:501; Interrogation_Position=947; Antisense; GTCGCAACTTCCTTATGAACCCAAA
>probe:Drosophila_2:1635003_at:708:611; Interrogation_Position=962; Antisense; TGAACCCAAAGTCCGGCCTAAAGAT

Paste this into a BLAST search page for me
GAGCTGCTCAAGTTGTCCGACTATTTATTTGCGCAAAATCGCTCACCACTACTGCCCGGATTTCAATTCGCTAAAGAGCACTACCATCCCAAGAAGAACTAAGAACTCCTGAACTTATCCTCGGTTAGACTATACCCTATTCGATCACCGGGAGCTAATGCGTCCGTATCTGCACGTATCTGCACGAGTTTCTGACTTCCAAGGTGATGTTCTATCTGGACTCCAGATATCAGTTCATGTGCCGGAGCGCGTAATCTGGGCCCTGTACAAGCAATTGTTTGATGACATCCGTCGCAACTTGTCGCAACTTCCTTATGAACCCAAATGAACCCAAAGTCCGGCCTAAAGAT

Full Affymetrix probeset data:

Annotations for 1635003_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720