FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635004_at:

>probe:Drosophila_2:1635004_at:560:659; Interrogation_Position=111; Antisense; TAAAATTAAACTATACGGCTCACCG
>probe:Drosophila_2:1635004_at:69:301; Interrogation_Position=134; Antisense; CGCCCGATCGCGATAATCTGGAAGT
>probe:Drosophila_2:1635004_at:515:427; Interrogation_Position=166; Antisense; GAGATACTCGAGGTCAATGGCCTGA
>probe:Drosophila_2:1635004_at:723:493; Interrogation_Position=178; Antisense; GTCAATGGCCTGACCCTGGAGAATA
>probe:Drosophila_2:1635004_at:719:411; Interrogation_Position=189; Antisense; GACCCTGGAGAATATATCGCGCACG
>probe:Drosophila_2:1635004_at:192:141; Interrogation_Position=211; Antisense; ACGGAGGTCATTCGGCACATACACG
>probe:Drosophila_2:1635004_at:564:629; Interrogation_Position=221; Antisense; TTCGGCACATACACGACGTACGGTT
>probe:Drosophila_2:1635004_at:525:25; Interrogation_Position=228; Antisense; CATACACGACGTACGGTTACCCCAT
>probe:Drosophila_2:1635004_at:267:307; Interrogation_Position=267; Antisense; CCTTGTGGTCAACATCCTGAGCATT
>probe:Drosophila_2:1635004_at:696:493; Interrogation_Position=274; Antisense; GTCAACATCCTGAGCATTCCTAATT
>probe:Drosophila_2:1635004_at:123:587; Interrogation_Position=42; Antisense; TGGAGAGTGGGTACAACAAGTTGTC
>probe:Drosophila_2:1635004_at:179:161; Interrogation_Position=57; Antisense; ACAAGTTGTCGAACTATCGGGCTAT
>probe:Drosophila_2:1635004_at:75:385; Interrogation_Position=67; Antisense; GAACTATCGGGCTATGTCATCATAC
>probe:Drosophila_2:1635004_at:588:571; Interrogation_Position=76; Antisense; GGCTATGTCATCATACTCGTCGAAA

Paste this into a BLAST search page for me
TAAAATTAAACTATACGGCTCACCGCGCCCGATCGCGATAATCTGGAAGTGAGATACTCGAGGTCAATGGCCTGAGTCAATGGCCTGACCCTGGAGAATAGACCCTGGAGAATATATCGCGCACGACGGAGGTCATTCGGCACATACACGTTCGGCACATACACGACGTACGGTTCATACACGACGTACGGTTACCCCATCCTTGTGGTCAACATCCTGAGCATTGTCAACATCCTGAGCATTCCTAATTTGGAGAGTGGGTACAACAAGTTGTCACAAGTTGTCGAACTATCGGGCTATGAACTATCGGGCTATGTCATCATACGGCTATGTCATCATACTCGTCGAAA

Full Affymetrix probeset data:

Annotations for 1635004_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720