Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635006_at:

>probe:Drosophila_2:1635006_at:363:371; Interrogation_Position=387; Antisense; GAAGGCCAACTTCCTGAGCGAATCC
>probe:Drosophila_2:1635006_at:140:603; Interrogation_Position=434; Antisense; TGTTCGACACGAATGTGGTGGCCAC
>probe:Drosophila_2:1635006_at:52:179; Interrogation_Position=484; Antisense; AAACACATGGCTGCGGTCAAGGTTC
>probe:Drosophila_2:1635006_at:401:221; Interrogation_Position=502; Antisense; AAGGTTCGCGGTCACATTGTGGTCA
>probe:Drosophila_2:1635006_at:326:55; Interrogation_Position=526; Antisense; ATGAACAGCGTGCTTGGCCATCGGA
>probe:Drosophila_2:1635006_at:578:545; Interrogation_Position=555; Antisense; GGAAGTGCCGGTGCCCTTATTCAGC
>probe:Drosophila_2:1635006_at:18:691; Interrogation_Position=572; Antisense; TATTCAGCGTTTATCCGGCCACGAA
>probe:Drosophila_2:1635006_at:143:137; Interrogation_Position=592; Antisense; ACGAAGCATGCAATTACGGCCCTCT
>probe:Drosophila_2:1635006_at:370:643; Interrogation_Position=614; Antisense; TCTGCCAAACGGTGCGCCAGGAAAT
>probe:Drosophila_2:1635006_at:92:161; Interrogation_Position=661; Antisense; AAATTAACGAGCATTTGCCCGGGCA
>probe:Drosophila_2:1635006_at:25:525; Interrogation_Position=681; Antisense; GGGCATGGTAGACACGGATTTCCTT
>probe:Drosophila_2:1635006_at:18:513; Interrogation_Position=696; Antisense; GGATTTCCTTAGTGTTTACTCGCAG
>probe:Drosophila_2:1635006_at:472:251; Interrogation_Position=762; Antisense; CAAGGCCGTGTTGTATGCGCTGAAC
>probe:Drosophila_2:1635006_at:240:611; Interrogation_Position=782; Antisense; TGAACACTCCCGATGGCGTCCAGGT

Paste this into a BLAST search page for me
GAAGGCCAACTTCCTGAGCGAATCCTGTTCGACACGAATGTGGTGGCCACAAACACATGGCTGCGGTCAAGGTTCAAGGTTCGCGGTCACATTGTGGTCAATGAACAGCGTGCTTGGCCATCGGAGGAAGTGCCGGTGCCCTTATTCAGCTATTCAGCGTTTATCCGGCCACGAAACGAAGCATGCAATTACGGCCCTCTTCTGCCAAACGGTGCGCCAGGAAATAAATTAACGAGCATTTGCCCGGGCAGGGCATGGTAGACACGGATTTCCTTGGATTTCCTTAGTGTTTACTCGCAGCAAGGCCGTGTTGTATGCGCTGAACTGAACACTCCCGATGGCGTCCAGGT

Full Affymetrix probeset data:

Annotations for 1635006_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime