Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635007_at:

>probe:Drosophila_2:1635007_at:392:723; Interrogation_Position=3410; Antisense; TTGCTTGCCCGCTTCTAATCTTTGG
>probe:Drosophila_2:1635007_at:187:655; Interrogation_Position=3425; Antisense; TAATCTTTGGTTTGCCCCATTTAAT
>probe:Drosophila_2:1635007_at:138:461; Interrogation_Position=3499; Antisense; GATTTCTTTTATCAAACTGTGTGTA
>probe:Drosophila_2:1635007_at:601:285; Interrogation_Position=3515; Antisense; CTGTGTGTAGTACAGTCCTTGCTAC
>probe:Drosophila_2:1635007_at:420:87; Interrogation_Position=3528; Antisense; AGTCCTTGCTACATTTGGCTTGCAA
>probe:Drosophila_2:1635007_at:643:279; Interrogation_Position=3568; Antisense; CTACATTTTTGACTAGCTTCTAGGC
>probe:Drosophila_2:1635007_at:230:115; Interrogation_Position=3582; Antisense; AGCTTCTAGGCCACCTAATTTGTAA
>probe:Drosophila_2:1635007_at:130:699; Interrogation_Position=3732; Antisense; TTTATTGGCCAATGCTAACGGAAAA
>probe:Drosophila_2:1635007_at:273:203; Interrogation_Position=3782; Antisense; AACCATATTTATGTCGAACTAGATA
>probe:Drosophila_2:1635007_at:587:361; Interrogation_Position=3839; Antisense; GAATTCCCAAAGACGTTTTGTAGCA
>probe:Drosophila_2:1635007_at:648:405; Interrogation_Position=3850; Antisense; GACGTTTTGTAGCAGTCCAGCTTAA
>probe:Drosophila_2:1635007_at:296:115; Interrogation_Position=3860; Antisense; AGCAGTCCAGCTTAAAATCGAACAA
>probe:Drosophila_2:1635007_at:150:481; Interrogation_Position=3892; Antisense; GTATTTGCCACGTTATAAATGTCAT
>probe:Drosophila_2:1635007_at:576:61; Interrogation_Position=3910; Antisense; ATGTCATCAAATTCACTCAAGATTG

Paste this into a BLAST search page for me
TTGCTTGCCCGCTTCTAATCTTTGGTAATCTTTGGTTTGCCCCATTTAATGATTTCTTTTATCAAACTGTGTGTACTGTGTGTAGTACAGTCCTTGCTACAGTCCTTGCTACATTTGGCTTGCAACTACATTTTTGACTAGCTTCTAGGCAGCTTCTAGGCCACCTAATTTGTAATTTATTGGCCAATGCTAACGGAAAAAACCATATTTATGTCGAACTAGATAGAATTCCCAAAGACGTTTTGTAGCAGACGTTTTGTAGCAGTCCAGCTTAAAGCAGTCCAGCTTAAAATCGAACAAGTATTTGCCACGTTATAAATGTCATATGTCATCAAATTCACTCAAGATTG

Full Affymetrix probeset data:

Annotations for 1635007_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime