FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635008_at:

>probe:Drosophila_2:1635008_at:730:715; Interrogation_Position=1152; Antisense; TTCGAAAGTGGACTCTAGCCGCCGC
>probe:Drosophila_2:1635008_at:581:557; Interrogation_Position=1198; Antisense; GGACTACACGCTCACGGATGATGAT
>probe:Drosophila_2:1635008_at:724:469; Interrogation_Position=1234; Antisense; GTTCGACTTCAAGGTAGGCGACCGA
>probe:Drosophila_2:1635008_at:143:679; Interrogation_Position=1248; Antisense; TAGGCGACCGAATCAACATTCCCAT
>probe:Drosophila_2:1635008_at:525:1; Interrogation_Position=1271; Antisense; ATTTCCGGGTTGCACTTGGATGACC
>probe:Drosophila_2:1635008_at:445:729; Interrogation_Position=1286; Antisense; TTGGATGACCGCTACTTCCCGGAAC
>probe:Drosophila_2:1635008_at:107:83; Interrogation_Position=1317; Antisense; AGTTTGACCCGGATCGATTTAGCGA
>probe:Drosophila_2:1635008_at:38:395; Interrogation_Position=1347; Antisense; GAAAGGGTGACATGGTGCCCTACAC
>probe:Drosophila_2:1635008_at:86:627; Interrogation_Position=1377; Antisense; TGCCATTCGGCGTGGGACCTAGGAA
>probe:Drosophila_2:1635008_at:129:43; Interrogation_Position=1413; Antisense; ATCGATATGCCTTGATGCAGGTCAA
>probe:Drosophila_2:1635008_at:648:653; Interrogation_Position=1434; Antisense; TCAAGGGTATGCTCTTCAACCTACT
>probe:Drosophila_2:1635008_at:278:617; Interrogation_Position=1461; Antisense; TGCATTACAAAATCGAGGCCTCCCC
>probe:Drosophila_2:1635008_at:218:653; Interrogation_Position=1524; Antisense; TCAATTTTACGCCTAGGTCCGGATT
>probe:Drosophila_2:1635008_at:541:547; Interrogation_Position=1551; Antisense; GGATGCACTTGGTGCCGCGAAAATA

Paste this into a BLAST search page for me
TTCGAAAGTGGACTCTAGCCGCCGCGGACTACACGCTCACGGATGATGATGTTCGACTTCAAGGTAGGCGACCGATAGGCGACCGAATCAACATTCCCATATTTCCGGGTTGCACTTGGATGACCTTGGATGACCGCTACTTCCCGGAACAGTTTGACCCGGATCGATTTAGCGAGAAAGGGTGACATGGTGCCCTACACTGCCATTCGGCGTGGGACCTAGGAAATCGATATGCCTTGATGCAGGTCAATCAAGGGTATGCTCTTCAACCTACTTGCATTACAAAATCGAGGCCTCCCCTCAATTTTACGCCTAGGTCCGGATTGGATGCACTTGGTGCCGCGAAAATA

Full Affymetrix probeset data:

Annotations for 1635008_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720