Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635009_at:

>probe:Drosophila_2:1635009_at:3:317; Interrogation_Position=2825; Antisense; GCCGTATATTGGATAACATTCTCTG
>probe:Drosophila_2:1635009_at:23:191; Interrogation_Position=2839; Antisense; AACATTCTCTGCATACAGTACACTT
>probe:Drosophila_2:1635009_at:276:155; Interrogation_Position=2853; Antisense; ACAGTACACTTCACTAATGCGTAAA
>probe:Drosophila_2:1635009_at:680:1; Interrogation_Position=2876; Antisense; AAGTTACTTAGTTGCATACGAATTA
>probe:Drosophila_2:1635009_at:696:683; Interrogation_Position=3113; Antisense; TATCGCTTACATTCAATTAATACGC
>probe:Drosophila_2:1635009_at:324:671; Interrogation_Position=3133; Antisense; TACGCAACTCACAAATGAGCGCCCA
>probe:Drosophila_2:1635009_at:386:55; Interrogation_Position=3147; Antisense; ATGAGCGCCCACTGCTAATAATATT
>probe:Drosophila_2:1635009_at:382:703; Interrogation_Position=3170; Antisense; TTATTATTAATAATCGCCTGAGCGC
>probe:Drosophila_2:1635009_at:108:635; Interrogation_Position=3183; Antisense; TCGCCTGAGCGCCAAGTTGTAAATA
>probe:Drosophila_2:1635009_at:501:629; Interrogation_Position=3241; Antisense; TCCGATTTTTTGAAGGGCCGGCATC
>probe:Drosophila_2:1635009_at:535:83; Interrogation_Position=3254; Antisense; AGGGCCGGCATCATAATAATAACAA
>probe:Drosophila_2:1635009_at:616:7; Interrogation_Position=3284; Antisense; ATATAAACAGTTTCGTGGCCTACTT
>probe:Drosophila_2:1635009_at:365:477; Interrogation_Position=3293; Antisense; GTTTCGTGGCCTACTTAAAAGATCT
>probe:Drosophila_2:1635009_at:390:651; Interrogation_Position=3337; Antisense; TAATAACACTTATCGCGCAAATGAG

Paste this into a BLAST search page for me
GCCGTATATTGGATAACATTCTCTGAACATTCTCTGCATACAGTACACTTACAGTACACTTCACTAATGCGTAAAAAGTTACTTAGTTGCATACGAATTATATCGCTTACATTCAATTAATACGCTACGCAACTCACAAATGAGCGCCCAATGAGCGCCCACTGCTAATAATATTTTATTATTAATAATCGCCTGAGCGCTCGCCTGAGCGCCAAGTTGTAAATATCCGATTTTTTGAAGGGCCGGCATCAGGGCCGGCATCATAATAATAACAAATATAAACAGTTTCGTGGCCTACTTGTTTCGTGGCCTACTTAAAAGATCTTAATAACACTTATCGCGCAAATGAG

Full Affymetrix probeset data:

Annotations for 1635009_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime