FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635011_at:

>probe:Drosophila_2:1635011_at:202:351; Interrogation_Position=185; Antisense; GCAGCGATCCCGAGTACAAGAAGAA
>probe:Drosophila_2:1635011_at:468:371; Interrogation_Position=204; Antisense; GAAGAAAGTCCGTGAGCGTCGCCGT
>probe:Drosophila_2:1635011_at:481:609; Interrogation_Position=216; Antisense; TGAGCGTCGCCGTCGCAACAAGAAA
>probe:Drosophila_2:1635011_at:34:387; Interrogation_Position=237; Antisense; GAAAACCGGCACTGCCAAGTCTGGA
>probe:Drosophila_2:1635011_at:548:311; Interrogation_Position=250; Antisense; GCCAAGTCTGGAGTTCCCAATCTGA
>probe:Drosophila_2:1635011_at:196:237; Interrogation_Position=267; Antisense; CAATCTGAACGACCATGAAGCCATC
>probe:Drosophila_2:1635011_at:57:107; Interrogation_Position=309; Antisense; AGAAATCCAGCTGGGCGAGACCCTG
>probe:Drosophila_2:1635011_at:110:449; Interrogation_Position=333; Antisense; GATCGCCCGCGGAGATTTCGAGAGT
>probe:Drosophila_2:1635011_at:57:331; Interrogation_Position=359; Antisense; GCGTGGAGCACTTGGCGAATGCCAT
>probe:Drosophila_2:1635011_at:125:235; Interrogation_Position=376; Antisense; AATGCCATCGTCGTGTGTGGCCAGC
>probe:Drosophila_2:1635011_at:633:275; Interrogation_Position=433; Antisense; CTTCCAGCTCAAGTATTCGCGATGC
>probe:Drosophila_2:1635011_at:260:419; Interrogation_Position=528; Antisense; GAGCTCGGAGCAACAACTGGACGGA
>probe:Drosophila_2:1635011_at:124:561; Interrogation_Position=577; Antisense; GGAAACGCAAGTATCGACGACCTCG
>probe:Drosophila_2:1635011_at:399:21; Interrogation_Position=693; Antisense; ATATTGATTTCTCTGGATGTTCCCA

Paste this into a BLAST search page for me
GCAGCGATCCCGAGTACAAGAAGAAGAAGAAAGTCCGTGAGCGTCGCCGTTGAGCGTCGCCGTCGCAACAAGAAAGAAAACCGGCACTGCCAAGTCTGGAGCCAAGTCTGGAGTTCCCAATCTGACAATCTGAACGACCATGAAGCCATCAGAAATCCAGCTGGGCGAGACCCTGGATCGCCCGCGGAGATTTCGAGAGTGCGTGGAGCACTTGGCGAATGCCATAATGCCATCGTCGTGTGTGGCCAGCCTTCCAGCTCAAGTATTCGCGATGCGAGCTCGGAGCAACAACTGGACGGAGGAAACGCAAGTATCGACGACCTCGATATTGATTTCTCTGGATGTTCCCA

Full Affymetrix probeset data:

Annotations for 1635011_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720