Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635015_at:

>probe:Drosophila_2:1635015_at:533:671; Interrogation_Position=1035; Antisense; TACGCTCACATCCTTCGACAGTGAT
>probe:Drosophila_2:1635015_at:531:153; Interrogation_Position=1052; Antisense; ACAGTGATATCGGACACGGCCTGAA
>probe:Drosophila_2:1635015_at:155:141; Interrogation_Position=1067; Antisense; ACGGCCTGAAAGAACGCGAGTCGCA
>probe:Drosophila_2:1635015_at:304:345; Interrogation_Position=1158; Antisense; GCATCATTATCACGCCCATGTGGGT
>probe:Drosophila_2:1635015_at:319:637; Interrogation_Position=1252; Antisense; TCGAGCGTGACGAGCATCATGCCAT
>probe:Drosophila_2:1635015_at:464:35; Interrogation_Position=1267; Antisense; ATCATGCCATGGAAGCACCGCCAGT
>probe:Drosophila_2:1635015_at:492:631; Interrogation_Position=1315; Antisense; TCCGGCACGAATTCGTTCCGTAAGT
>probe:Drosophila_2:1635015_at:154:115; Interrogation_Position=788; Antisense; AGCAGATGCAACATGCGGAGCAACA
>probe:Drosophila_2:1635015_at:524:37; Interrogation_Position=844; Antisense; ATCTTTCACACCAGCAGCATGGATT
>probe:Drosophila_2:1635015_at:229:591; Interrogation_Position=868; Antisense; TGGTCGCTGCCAATTAATAGTCGCA
>probe:Drosophila_2:1635015_at:60:241; Interrogation_Position=883; Antisense; AATAGTCGCAGCTTTGGCAATTTAG
>probe:Drosophila_2:1635015_at:322:187; Interrogation_Position=910; Antisense; AACATCGATGGTTCGGGCGGTACTG
>probe:Drosophila_2:1635015_at:142:721; Interrogation_Position=939; Antisense; TTGCCGTGTGCCGTACCAGAAAATG
>probe:Drosophila_2:1635015_at:729:591; Interrogation_Position=987; Antisense; TGGTGCAATGGCAAACGGCTGCTTG

Paste this into a BLAST search page for me
TACGCTCACATCCTTCGACAGTGATACAGTGATATCGGACACGGCCTGAAACGGCCTGAAAGAACGCGAGTCGCAGCATCATTATCACGCCCATGTGGGTTCGAGCGTGACGAGCATCATGCCATATCATGCCATGGAAGCACCGCCAGTTCCGGCACGAATTCGTTCCGTAAGTAGCAGATGCAACATGCGGAGCAACAATCTTTCACACCAGCAGCATGGATTTGGTCGCTGCCAATTAATAGTCGCAAATAGTCGCAGCTTTGGCAATTTAGAACATCGATGGTTCGGGCGGTACTGTTGCCGTGTGCCGTACCAGAAAATGTGGTGCAATGGCAAACGGCTGCTTG

Full Affymetrix probeset data:

Annotations for 1635015_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime