Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635016_at:

>probe:Drosophila_2:1635016_at:643:229; Interrogation_Position=1117; Antisense; AATGTTCTGCGGTATGCATGCAACC
>probe:Drosophila_2:1635016_at:593:235; Interrogation_Position=1151; Antisense; AATCCCATGCTACTTTTGTCGACGG
>probe:Drosophila_2:1635016_at:122:375; Interrogation_Position=1207; Antisense; GAAGATCCAGGCTCAACCACATTTG
>probe:Drosophila_2:1635016_at:429:19; Interrogation_Position=1227; Antisense; ATTTGCTTATCGATGTGCGGCCAAC
>probe:Drosophila_2:1635016_at:226:333; Interrogation_Position=1243; Antisense; GCGGCCAACTGCAGAATTCGAGATT
>probe:Drosophila_2:1635016_at:307:597; Interrogation_Position=1291; Antisense; TGTGCCACTGGTAGAGATCCTCGAC
>probe:Drosophila_2:1635016_at:14:449; Interrogation_Position=1306; Antisense; GATCCTCGACGACAGCTATCTTAAG
>probe:Drosophila_2:1635016_at:558:557; Interrogation_Position=1351; Antisense; GGACAAGGAACTGCCCATCGTACTG
>probe:Drosophila_2:1635016_at:672:655; Interrogation_Position=1390; Antisense; TAATGATTCGCAGATCGCCGTTCAG
>probe:Drosophila_2:1635016_at:411:635; Interrogation_Position=1443; Antisense; TCGTTCGAGACCTGATTGGCGGACT
>probe:Drosophila_2:1635016_at:421:729; Interrogation_Position=1458; Antisense; TTGGCGGACTGCATGCCTGGACGAA
>probe:Drosophila_2:1635016_at:248:555; Interrogation_Position=1476; Antisense; GGACGAACAGTGTAGACCCCAGTTT
>probe:Drosophila_2:1635016_at:74:461; Interrogation_Position=1548; Antisense; GATTTATTCATTGTTTCTCCTGCAA
>probe:Drosophila_2:1635016_at:626:115; Interrogation_Position=1602; Antisense; AGCTCTTACGTATGTCTTGTTATCA

Paste this into a BLAST search page for me
AATGTTCTGCGGTATGCATGCAACCAATCCCATGCTACTTTTGTCGACGGGAAGATCCAGGCTCAACCACATTTGATTTGCTTATCGATGTGCGGCCAACGCGGCCAACTGCAGAATTCGAGATTTGTGCCACTGGTAGAGATCCTCGACGATCCTCGACGACAGCTATCTTAAGGGACAAGGAACTGCCCATCGTACTGTAATGATTCGCAGATCGCCGTTCAGTCGTTCGAGACCTGATTGGCGGACTTTGGCGGACTGCATGCCTGGACGAAGGACGAACAGTGTAGACCCCAGTTTGATTTATTCATTGTTTCTCCTGCAAAGCTCTTACGTATGTCTTGTTATCA

Full Affymetrix probeset data:

Annotations for 1635016_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime