FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635018_at:

>probe:Drosophila_2:1635018_at:390:615; Interrogation_Position=1454; Antisense; TGAAGGCTCTGTTGCGCATCTGGCT
>probe:Drosophila_2:1635018_at:337:41; Interrogation_Position=1471; Antisense; ATCTGGCTGAAGTCAAACTCCTCGT
>probe:Drosophila_2:1635018_at:470:327; Interrogation_Position=1541; Antisense; GCGTAACCACACTGAATGCGGGAAG
>probe:Drosophila_2:1635018_at:707:719; Interrogation_Position=1611; Antisense; TTCCGGACTCTTTTCAAGCAGCAAT
>probe:Drosophila_2:1635018_at:304:1; Interrogation_Position=1636; Antisense; ATTCGCTTTAAGCACTACGACTTCG
>probe:Drosophila_2:1635018_at:66:671; Interrogation_Position=1651; Antisense; TACGACTTCGATACGGACACCCACA
>probe:Drosophila_2:1635018_at:534:157; Interrogation_Position=1673; Antisense; ACACGGCGGAGCAGATCCACAACAA
>probe:Drosophila_2:1635018_at:89:449; Interrogation_Position=1721; Antisense; GATCCAGCGATCTGAGGCGCGAGTT
>probe:Drosophila_2:1635018_at:72:429; Interrogation_Position=1741; Antisense; GAGTTCCTTTTGCAGCGCGATCGGA
>probe:Drosophila_2:1635018_at:123:483; Interrogation_Position=1794; Antisense; GTATTTATTCCTATGGCAGCGGCTG
>probe:Drosophila_2:1635018_at:351:303; Interrogation_Position=1893; Antisense; CCGCCTCCTGTTCGATAAGTTGTAT
>probe:Drosophila_2:1635018_at:56:515; Interrogation_Position=1937; Antisense; GTGTTACACATGTTTGCCTAGCCTG
>probe:Drosophila_2:1635018_at:118:703; Interrogation_Position=1969; Antisense; TTATTGAACTCACCCAACTACGAAG
>probe:Drosophila_2:1635018_at:199:193; Interrogation_Position=1984; Antisense; AACTACGAAGCCTGGTCCTGAAAAT

Paste this into a BLAST search page for me
TGAAGGCTCTGTTGCGCATCTGGCTATCTGGCTGAAGTCAAACTCCTCGTGCGTAACCACACTGAATGCGGGAAGTTCCGGACTCTTTTCAAGCAGCAATATTCGCTTTAAGCACTACGACTTCGTACGACTTCGATACGGACACCCACAACACGGCGGAGCAGATCCACAACAAGATCCAGCGATCTGAGGCGCGAGTTGAGTTCCTTTTGCAGCGCGATCGGAGTATTTATTCCTATGGCAGCGGCTGCCGCCTCCTGTTCGATAAGTTGTATGTGTTACACATGTTTGCCTAGCCTGTTATTGAACTCACCCAACTACGAAGAACTACGAAGCCTGGTCCTGAAAAT

Full Affymetrix probeset data:

Annotations for 1635018_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720