FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635019_at:

>probe:Drosophila_2:1635019_at:444:47; Interrogation_Position=221; Antisense; ATCCGGAGCACGCTGTGTCCATGAG
>probe:Drosophila_2:1635019_at:6:517; Interrogation_Position=235; Antisense; GTGTCCATGAGCATCGAGCAGCAGG
>probe:Drosophila_2:1635019_at:66:609; Interrogation_Position=267; Antisense; TGAGCTGCCCGAGCAAGTGGAGTAC
>probe:Drosophila_2:1635019_at:293:445; Interrogation_Position=361; Antisense; GATGAGCAGGAAGTCATGCCCTCCT
>probe:Drosophila_2:1635019_at:250:605; Interrogation_Position=408; Antisense; TGCACCCGTAACAGTTCCAGTTCAG
>probe:Drosophila_2:1635019_at:21:629; Interrogation_Position=423; Antisense; TCCAGTTCAGATGGCCATTGATCCC
>probe:Drosophila_2:1635019_at:95:607; Interrogation_Position=452; Antisense; TGATGCCCCAAATGGAAGCTGTCAT
>probe:Drosophila_2:1635019_at:527:353; Interrogation_Position=526; Antisense; GCACCAGTTTCTGAGCAGCAGCTGA
>probe:Drosophila_2:1635019_at:682:113; Interrogation_Position=578; Antisense; AGCAGATCCAGATGCACGATGCGCC
>probe:Drosophila_2:1635019_at:433:437; Interrogation_Position=646; Antisense; GAGGAGCAGCAACCAACTTACGTTC
>probe:Drosophila_2:1635019_at:288:309; Interrogation_Position=658; Antisense; CCAACTTACGTTCTGGATGTCCAGC
>probe:Drosophila_2:1635019_at:74:213; Interrogation_Position=713; Antisense; AAGAGCAGCTGGAACCGGAGCCCGC
>probe:Drosophila_2:1635019_at:144:193; Interrogation_Position=743; Antisense; AACTCCGTGCCGATGGCTATCACTA
>probe:Drosophila_2:1635019_at:464:561; Interrogation_Position=780; Antisense; GGAACAGCGTCGTCTGCGGCATTGA

Paste this into a BLAST search page for me
ATCCGGAGCACGCTGTGTCCATGAGGTGTCCATGAGCATCGAGCAGCAGGTGAGCTGCCCGAGCAAGTGGAGTACGATGAGCAGGAAGTCATGCCCTCCTTGCACCCGTAACAGTTCCAGTTCAGTCCAGTTCAGATGGCCATTGATCCCTGATGCCCCAAATGGAAGCTGTCATGCACCAGTTTCTGAGCAGCAGCTGAAGCAGATCCAGATGCACGATGCGCCGAGGAGCAGCAACCAACTTACGTTCCCAACTTACGTTCTGGATGTCCAGCAAGAGCAGCTGGAACCGGAGCCCGCAACTCCGTGCCGATGGCTATCACTAGGAACAGCGTCGTCTGCGGCATTGA

Full Affymetrix probeset data:

Annotations for 1635019_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720