Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635021_at:

>probe:Drosophila_2:1635021_at:408:211; Interrogation_Position=4326; Antisense; AAGACTCCAGGCTATTGCAATATGC
>probe:Drosophila_2:1635021_at:440:509; Interrogation_Position=4373; Antisense; GTGACATTTCACATTCGATGCTCCA
>probe:Drosophila_2:1635021_at:580:445; Interrogation_Position=4389; Antisense; GATGCTCCAGCCAAGTGAAAACGAT
>probe:Drosophila_2:1635021_at:252:247; Interrogation_Position=4427; Antisense; CAATTAGCGGGAGGTACTGGGTACT
>probe:Drosophila_2:1635021_at:691:631; Interrogation_Position=4448; Antisense; TACTCTGGGTACTGGGTCTTTGTCG
>probe:Drosophila_2:1635021_at:583:497; Interrogation_Position=4463; Antisense; GTCTTTGTCGGTAGGACTGTACGAT
>probe:Drosophila_2:1635021_at:356:407; Interrogation_Position=4488; Antisense; GACGGTATTATTAGTTCTTAGCCAA
>probe:Drosophila_2:1635021_at:681:129; Interrogation_Position=4513; Antisense; ACGTTTCAACGCTGTTTATGTTCTT
>probe:Drosophila_2:1635021_at:88:217; Interrogation_Position=4583; Antisense; AAGTTGGGCCGCATTGTTGGCGCCA
>probe:Drosophila_2:1635021_at:490:465; Interrogation_Position=4598; Antisense; GTTGGCGCCAGCAAGATGTAGTTAC
>probe:Drosophila_2:1635021_at:130:599; Interrogation_Position=4657; Antisense; TGTCTATCCTAGTTGTATGCGTTCA
>probe:Drosophila_2:1635021_at:475:107; Interrogation_Position=4689; Antisense; AGAACATACACACGCTCACGTTTGT
>probe:Drosophila_2:1635021_at:224:13; Interrogation_Position=4810; Antisense; ATTACCTGCAACAAAATGGCCCTGT
>probe:Drosophila_2:1635021_at:614:67; Interrogation_Position=4825; Antisense; ATGGCCCTGTACTTCCTTCATTGAA

Paste this into a BLAST search page for me
AAGACTCCAGGCTATTGCAATATGCGTGACATTTCACATTCGATGCTCCAGATGCTCCAGCCAAGTGAAAACGATCAATTAGCGGGAGGTACTGGGTACTTACTCTGGGTACTGGGTCTTTGTCGGTCTTTGTCGGTAGGACTGTACGATGACGGTATTATTAGTTCTTAGCCAAACGTTTCAACGCTGTTTATGTTCTTAAGTTGGGCCGCATTGTTGGCGCCAGTTGGCGCCAGCAAGATGTAGTTACTGTCTATCCTAGTTGTATGCGTTCAAGAACATACACACGCTCACGTTTGTATTACCTGCAACAAAATGGCCCTGTATGGCCCTGTACTTCCTTCATTGAA

Full Affymetrix probeset data:

Annotations for 1635021_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime