FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635023_at:

>probe:Drosophila_2:1635023_at:335:351; Interrogation_Position=111; Antisense; GCAGTTCTCTCAAATCTGGGCAGAT
>probe:Drosophila_2:1635023_at:643:99; Interrogation_Position=132; Antisense; AGATGGGCCTACAATCTCTCCGGAT
>probe:Drosophila_2:1635023_at:716:249; Interrogation_Position=162; Antisense; CAATACGGTCTGCATCGCGATGATT
>probe:Drosophila_2:1635023_at:625:317; Interrogation_Position=223; Antisense; GCCGATTGCCCAGGAAGCTGTACGA
>probe:Drosophila_2:1635023_at:727:491; Interrogation_Position=253; Antisense; GTAACTACCGCATCATGAGGGCCCT
>probe:Drosophila_2:1635023_at:455:39; Interrogation_Position=280; Antisense; ATCTGTCCATGACCAAGACCATTCT
>probe:Drosophila_2:1635023_at:353:547; Interrogation_Position=332; Antisense; GGAGGACGTCAAGTATCTGGAACCC
>probe:Drosophila_2:1635023_at:18:41; Interrogation_Position=346; Antisense; ATCTGGAACCCTACCTCAAGGAGGT
>probe:Drosophila_2:1635023_at:239:569; Interrogation_Position=36; Antisense; GGCTGGAGGAATATCTCTTTCCCGA
>probe:Drosophila_2:1635023_at:677:387; Interrogation_Position=402; Antisense; GAAAAGATCCACTAAACGCGCCACT
>probe:Drosophila_2:1635023_at:249:665; Interrogation_Position=426; Antisense; TAAATCCCTCTACTTTGGACTTGTA
>probe:Drosophila_2:1635023_at:699:643; Interrogation_Position=51; Antisense; TCTTTCCCGACTTCTGATTTTACGT
>probe:Drosophila_2:1635023_at:514:203; Interrogation_Position=77; Antisense; AACCATGTCGAACTATATTGCCAGA
>probe:Drosophila_2:1635023_at:558:719; Interrogation_Position=94; Antisense; TTGCCAGAAAGGGACCCGCAGTTCT

Paste this into a BLAST search page for me
GCAGTTCTCTCAAATCTGGGCAGATAGATGGGCCTACAATCTCTCCGGATCAATACGGTCTGCATCGCGATGATTGCCGATTGCCCAGGAAGCTGTACGAGTAACTACCGCATCATGAGGGCCCTATCTGTCCATGACCAAGACCATTCTGGAGGACGTCAAGTATCTGGAACCCATCTGGAACCCTACCTCAAGGAGGTGGCTGGAGGAATATCTCTTTCCCGAGAAAAGATCCACTAAACGCGCCACTTAAATCCCTCTACTTTGGACTTGTATCTTTCCCGACTTCTGATTTTACGTAACCATGTCGAACTATATTGCCAGATTGCCAGAAAGGGACCCGCAGTTCT

Full Affymetrix probeset data:

Annotations for 1635023_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720